BIO UNIT 2

Heritable variation

mutation is the primary source of variation in the DNA

two processes that generate variation (or new traits)

1. mutation

2. genetic recombination

mutation

change in DNA base sequence; ultimate source of new alleles (genes)

DNA (deoxyribose nucleic acid)

-double strand of millions of nucleotides

-nucleotide consists of phosphate, sugar, and four types of bases: A,T,C,G

chromosome

-packaged/condensed DNA

-human have 46 packages, 23 pairs

-NOTE: chromosome and DNA are exactly the same!

Gene

-a sequence of DNA that codes for single genetic instruction (to make a protein)

-structural gene and regulatory gene

allele

a form or version of a gene

proteins

-features, characters, traits (morphological, behavioral, and physiological)

-protein production involves two steps and occurs in the ribosomes:

1. transcription

2. translation

transcription

-inside nucleus and results in RNA production from DNA

translation

-outside of nucleus at ribosomes, and results in protein

ribosomes

where protein production occurs

point mutation

-replacement of 1 nucleotide due to random errors in DNA synthesis or DNA repair

-mistake that occurs in copying

-ex: ACTGATTGGGAGACCTATTGC

ACTGATTGGGTGACCTATTGC

Mutation through insertion or deletion

addition or deletion of 1 or more base pairs

genetic recombination

results in new gene combinations (in sexual organisms) during meiosis

diploid

-two sets of chromosomes, 2n

-once sperm (n) fertilizes egg (n), zygote (2n) is formed and baby is conceived

2 sets of chromosomes in human

-homologous pair = similar size + function, but not exactly alike

-non-homologous pair = sex chromosomes

meiosis ensures variability in offspring

-by randomly selecting one or the other chromosome from a diploid set, enormous number of gametes arise

-by process of recombination (result of crossing over)

variation is ubiquitous

-morphological: hair color, height, etc

-behavioral: preference for certain foods, choice of clothing, etc.

-physiological: rate of metabolism

heredity

transmission of traits from one generation to the next

peas could be cross-fertilized

cross-fertilization includes collecting pollen from one individual and transferring to female organ of another plant whose male organ had been removed

how did white plants appear in Gregor Mendel’s experiment

flowers were white if dominant factor was absent, purple if dominant factor was present

monohybrid cross

tracks inheritance of a single trait

phenotype

-organism’s physical, behavioral, and physiological traits that can be seen (purple, white, tall, short, etc)

-its physical traits…observable

genotype

-organism’s genetic (allele) makeup that cannot be seen (PP, Pp, pp, TT, etc)

-combination of alleles…can’t be observed

homozygous

two same alleles (PP, pp, TT, etc.)

heterozygous

two different alleles (Pp, Tt, etc.)

Mendel’s law of segregation (from monohybrid crosses)

1. genes exist in alternative versions called alleles

2. for each characteristic, organism inherits two alleles, one from each parent. if alleles differ, dominant allele determines organism’s appearance!

3. allele pairs segregate during gamete production (meiosis) w/each carrying only one allele per gene. fertilization restores the paired condition

monohybrid cross example: Rr x Rr —3:1 phenotypic ratio

key assumption: one gene—> one character, with complete dominance

character

-an inherited feature that varies among individuals; gene

ex: human eye color

trait

-each possible variation of a character

-ex: alleles (alternate forms of a particular gene)

Punnett squares

-allows prediction of offspring’s genotype and phenotype

test cross

-used to determine whether an organism showing a dominant trait is homozygous dominant (AA) or heterozygous (Aa)

-ex: is genotype of a black lab BB or Bb (if its restive, we will know since its expressed but for this you can’t) so to find out, mate it with a chocolate Labrador (bb)

inheritance of dominant vs. recessive traits

-dominant allies are generally manifested in parent

-”harmful dominant” disorders are subject to selection, while “harmful recessive” traits are NOT subject to selection

(when dominant, the harmful gene shows up, so natural selection can act against it. however, when recessive, harmful gene can hide and natural selection can’t easily remove it.)

Mendel’s 2nd law of independent assortment (dihybrid crosses)

-alleles of different genes assort independently during gamete formation

-inheritance of one character has no effect on inheritance of another

-only true if genes on different chromosomes or are far apart on same chromosomes

-dihybrid cross ex: RrYy x RrYy → 9:3:3:1 phenotypic ratio

-key assumption: genes are independent; one gene → one trait

dihybrid cross

-two separate characters are studied

-four possible phenotypes in a ratio of 9:3:3:1 and this is the principle of independent assortment!

-alleles of different genes are transmitted independently of one another

principle of dependent assortment

-two possible phenotypes in a 3:1

-alleles of different genes would be transmitted dependently of one another

mendelian inheritance

-assumes one gene codes for one character (one allele dominant, other recessive)

-but there are variations/exceptions

variations/exceptions to Mendel’s law

1. polygenic inheritance

2. incomplete dominance

3. codominance

4. 
   

polygenic inheritance

-a single character is controlled by many genes (each gene has a small, additive effect)

-ex: beak depth, how this quantitative trait has organisms who have small beak, large beak, and in between

-human height is about 80% genetic and 20% environment. about 50 genes associated with height and each gene contributes a small amount. Result: continues variation from very short to very tall (and even in between)

incomplete dominance

-neither allele is completely dominant; the heterozygote has an intermediate phenotype

-ex: crossing red and white flower and getting pink. both alleles are partially expressed

codominance

-both alleles are “fully expressed”

-multiple allelism: a gene exists in more than two allelic forms in a population (individual may still has only two alleles, but the population may have many alleles)

-ex: blood types in humans have multiple alleles

difference between multiple alleles and polygenic inheritance

-multiple alleles is many forms of ONE gene

-polygenic means many different genes

multiple alleles is NOT THE SAME as polygenic inheritance

blood types in humans

-multiple alleles. 3 alleles for human blood gene: i, I^A, I^B

-these 3 alleles combine in six ways

-genotype of ii gives you phenotype of O

-genotype of i I^A OR I^AI^A give you phenotype A

-genotype of I I^B OR I^BI^B give you phenotype B

-genotype of I^A I^B give you phenotype AB

incomplete dominance vs codominance

-incomplete dominance: intermediate heterozygote phenotype, ex: pink snap dragons, allele expression: partial

-codominance: both traits fully expressed, ex: AB blood type, allele expression: full, separate

genotype of ii produces phenotype of

O

genotype of i I^A produces phenotype of

A

genotype of I^A I^A produces phenotype of

A

genotype of I^B I^B produces phenotype of

B

genotype of I^A I^B produces phenotype of

AB

genotype of i I^B produces phenotype of

B