biotech

Provide two examples of historical and current applications of biotechnology.

• Historical: 

  • using yeast (S. cerevisiae) to ferment bread: Yeast ferments bread by consuming sugars in the dough and converting them into carbon dioxide gas and alcohol

  • penicillin as an antibiotic (1940s): Penicillin is used as an antibiotic by binding to bacterial cell wall proteins to destroy active, multiplying bacteria.

• Current: 

  • recombinant human insulin (Genentech, 1982): Recombinant human insulin is made by inserting the human insulin gene into a host organism—typically E. coli bacteria or Saccharomyces cerevisiae yeast—which then produces the human protein through large-scale fermentation; 

  • DNA fingerprinting; maps genetic code to identify individuals in criminal investigations and paternity tests

Pick an example of a biotechnology application and describe how it has affected your everyday life.

A flu shot (vaccine): Recombinant Technology (Flublok): Scientists extract the gene that codes for the flu virus's surface protein (hemagglutinin) and combine it with a baculovirus system or host cells, allowing large quantities of pure viral antigen to be manufactured synthetically and then used in vaccines. 

Which area of biotechnology involves using living organisms to clean up the environment?

Bioremediation: after the 1989 Exxon Valdez oil spill, scientists added nutrients to stimulate native Pseudomonas bacteria, which cleaned beaches about 3 times faster than chemicals alone,  releasing specialized enzymes that break complex, toxic pollutant molecules into smaller, safer pieces

Describe how precision medicine will influence the treatment of human diseases.

Precision medicine involves prescribing a treatment strategy based on specific information about the individual’s particular disease and their genetic profile. An RNA or DNA sample from a patient with a medical condition can be analyzed to determine whether the genes that person expresses match the genetic profile of a particular disease process. If they do, a specific treatment approach can be designed according to the best-known treatment strategy based on the patient’s genetic profile, with drugs that target specific protein(s) encoded by those genes.

Distinguish between QC and QA, and explain why both are important for biotechnology companies.

No product can leave a biotechnology company until it passes rigorous tests by the internal unit called quality control (QC). Quality assurance (QA) is responsible for monitoring everything that enters and leaves a company to ensure product safety and quality and tracing sources of problems identified by complaints as specified by regulatory agencies, such as the U.S. Food and Drug Administration (FDA). QA and QC measures are important for every step of research and development (R&D) as well as for product manufacturing, including packaging and marketing.

Lab-grown burgers: what do you think, why are scientists interested, advantages and disadvantages, ethics?

Advantages: less environmental harm from large animal farms and meat processing plants; fewer animals raised and slaughtered; production in controlled conditions.

Disadvantages: very expensive (about $18,000/lb vs about $5/lb for ground beef); taste and texture (scientists are adding fat cells); consumer acceptance.

Ethics: many see it as less ethically troubling than farming animals, while others object to it as "unnatural" food, similar to the GM food debate.

Should humans be cloned?

Context from the chapter: mammals (sheep, cows, and monkeys in Shanghai in 2018) have been cloned. No human cloning claim has been proven, and most scientists oppose it.

Arguments against: safety risks, identity and consent of the clone, and misuse.

Arguments for: a reproductive option for people who can't have children any other way.

What is genome editing, and why is it controversial?

Genome editing uses tools like CRISPR-Cas, which act as "molecular scissors," to cut out and replace a specific DNA sequence in an organism's genome.

Controversial because:

• Editing embryos creates inherited changes and "designer babies" with chosen traits.

• Off-target effects are possible.

• Gene-edited crops and animals (the mushroom, hornless cattle) largely fall outside current regulations.

• There are questions about fairness and access.

Explain how biotechnology companies get started. Include how a startup company is funded.

Biotechnology companies often begin with a discovery by a scientist working in academia. For example, a gene or protein is found to be important in a disease process and may have potential applications as a recombinant DNA product. Starting a biotechnology company, a “start-up” company, to develop this protein as a product then requires significant initial funding for preclinical research in animals and clinical trials. Sometimes a company starts with initial “seed money,” which may come from a few individual investors. Then if the product shows potential, the company will seek venture capital (from groups wishing to provide money for early-stage, high-risk high-reward-earning companies) or “angel” investors (individuals who provide capital for a start-up in exchange for ownership and profit making in the company).

Describe differences and similarities between the pharmaceutical industry and the biotechnology industry.

Similarity: both produce, sell, and market drugs for humans, and many large pharma companies have bought biotech companies and now do biotech Research and Development.

Difference: pharma uses synthetic chemical processes to make drug compounds (e.g., aspirin), while biotech uses living cells to produce drugs (e.g., recombinant proteins). Pharma also often makes medical devices.

23andMe and Precision FDA: do these screening tests predict Alzheimer's?

• These tests look for genetic risk variants (SNPs). They show increased risk, not a diagnosis. Alzheimer's is also influenced by other genes, age, and lifestyle, so a positive result doesn't mean you'll get the disease, and a negative one doesn't rule it out.

• Precision FDA: an aid to diagnosis for individuals aged 40 and older who are already experiencing signs or symptoms of cognitive impairment; measures blood biomarkers to help doctors identify brain amyloid plaques associated with Alzheimer’s disease

Apply the problem → methods → application approach (plus ethics and regulations) to something in this chapter.

• Problem: people with diabetes need insulin, and pig and cow insulin could trigger immune rejection.

• Methods: recombinant DNA technology. Insert the human insulin gene into bacteria and grow them in batches.

• Application: unlimited human insulin. Genentech's was the first biotech drug, in 1982.

• Ethics and regulations: drug pricing and access; FDA approval and QA/QC.

The nonbrowning white button mushroom and earlier GM crops were both genetically changed. How is a gene-edited crop different from a traditional GMO, and why does that matter for regulation?

• Traditional GMOs had new genes delivered by bacteria or viruses (often from plant pests). Scientists couldn't control where the genes were inserted, which raised worries about genetic disruption or cross-breeding.

• Gene-edited crops use CRISPR-Cas to snip and tweak the plant's own DNA at a precise location. The mushroom had one browning-enzyme gene inactivated, with no foreign gene added.

• Because no plant-pest genes are introduced, gene-edited crops largely fall outside current regulations, which were written for the older GMOs. The USDA only asks companies to show that no foreign plant-pest genes were added.

Two patients have the same type of arthritis, but the drug works for only one of them. Using SNPs, explain why, and how precision medicine would fix this.

• SNPs are single-nucleotide differences in DNA between individuals. Some don't change the protein, but others change how a protein works. That can change how a drug is processed or whether its target is present.

• The two patients likely carry different SNPs or different arthritis genes, so the drug fits one patient's biology but not the other's.

• Precision medicine: a blood test provides DNA for genetic analysis. The doctor identifies the genes involved and picks the drug that targets that patient's specific profile, avoiding wasted prescriptions and side effects.

Why would a company make a human protein in the milk of a transgenic goat instead of in bacteria? Give an example from the chapter.

• Many therapeutic proteins are needed in very large amounts (more than hundreds of kilograms). A female transgenic animal can secrete the protein in large volumes of milk or eggs, which is then purified.

• Animal cells also process human proteins more like human cells do than bacteria can.

• Examples: human clotting proteins produced in transgenetic goat milk

What is a biosimilar, and why don't biotech generics drop in price as much as regular generic drugs?

• A biosimilar is a generic version of a biologic drug, such as a recombinant protein or antibody, made after the original's patent (up to 20 years) expires.

• Regular generics are simple chemical copies. Biosimilars are made by living cells, so they're hard to copy exactly and require new, expensive manufacturing processes that must give the same or better results.

• As a result, biotech products remain more expensive to make than pharma products, so the savings are smaller. The biosimilar market was projected to exceed $55 billion by 2020.

How does nanotechnology help medicine?

Nanoparticles deliver drugs, genes, RNA, or antibodies directly to targeted cells. This spares healthy tissues from damage, increases drug effectiveness, and lowers side effects seen in traditional treatments like chemotherapy

Three differences between eukaryotic and prokaryotic cells

• Eukaryotes have a membrane-bound nucleus; prokaryotes keep their DNA in a nucleoid region.

• Eukaryotes have many organelles (mitochondria, ER, Golgi); prokaryotes have few, mainly ribosomes.

• Eukaryotes have linear chromosomes; prokaryotes usually have one circular chromosome.

Genes vs chromosomes

• A gene is a DNA sequence (about 1,000–4,000 nucleotides) that codes for an RNA, usually an mRNA that makes a protein.

• A chromosome is a tightly coiled package of DNA and protein that holds many genes. Chromosomes let cells divide DNA evenly during cell division.

Three differences between DNA and RNA

• DNA is double-stranded; RNA is single-stranded.

• DNA has thymine; RNA has uracil.

• DNA has deoxyribose; RNA has ribose.

• DNA is the inherited genetic material in the nucleus. RNA (mRNA, tRNA, rRNA, ncRNAs) is made by transcription and works mostly in the cytoplasm.

What is a genome, and what can we learn from it?

• A genome is all of the DNA in an organism's cells. Humans have about 20,000 genes in about 3 billion base pairs.

• Studying genomes (genomics) shows where genes are and what they do, finds disease genes and SNPs (which are the most common type of genetic variation among people), compares species, and supports diagnosis and treatment (precision medicine).

Three RNAs in protein synthesis

• mRNA: a copy of the gene that carries the codons from the nucleus to the cytoplasm.

• rRNA: forms the ribosome, which binds and "reads" the mRNA for translation.

• tRNA: brings amino acids to the ribosome. Its anticodon base-pairs with the codon during translation.

What does "gene expression" mean?

The process by which a cell uses the instructions encoded in a gene to create a functional product, such as a protein, including transcription and translation.

Why are ncRNAs important?

• They do jobs without coding for protein like mRNA: tRNA and rRNA run translation [rRNA: forms the ribosome, which binds and "reads" the mRNA for translation.

• tRNA: brings amino acids to the ribosome. Its anticodon base-pairs with the codon during translation], snRNA joins with proteins to form the spliceosome, which cuts and rejoins pre-mRNA to remove introns and connect exons

• miRNAs and siRNAs direct the RISC to target mRNAs, leading to gene silencing via mRNA degradation or translation blocking

What is gene expression regulation, and why does it matter?

How cells control how much RNA and protein they make, as needed. That's why different cell types differ even with the same genome.

• Epigenetics. DNA wraps tightly around histones. Chemical tags (like methylation) can cause this structure to coil tighter (blocking access) or loosen up, making genes physically accessible to be read.

• Transcription. Transcription factors bind to DNA to either recruit or block RNA Polymerase (the enzyme that copies DNA into RNA), controlling the initial volume of mRNA generated.

• mRNA Processing & Stability. Through alternative splicing, a cell can rearrange the exons of a single RNA strand to produce entirely different protein variations. The cell also controls how long an mRNA molecule survives before degrading through the length of poly-A tail.

• Translation. Molecules like microRNAs (miRNAs) can target specific mRNAs and intercept them, preventing the protein from being built at all.

What is an operon?

• A cluster of related genes under one promoter, mostly found in bacteria. It lets bacteria switch related genes on or off together.

• Example: the lac operon is repressed when there's no lactose (the repressor binds to the operator) and induced when lactose is present (lactose inactivates the repressor by binding to it).

Transcriptional regulation

Controlling how much mRNA is transcribed. Transcription factors and activators, which bind promoters and enhancers, help RNA polymerase and increase expression. Repressors decrease it, usually binding to the operator or promoter region and blocking RNA polymerase.

Why do some mutations cause disease and others don't?

• Silent mutations change a codon but not the amino acid, so the protein is unchanged, Mutations in introns, or ones that don't affect the protein's shape, usually have no effect.

• Missense mutations change the amino acid, which can matter (e.g., sickle cell disease).

• Nonsense mutations create an early stop codon, giving a shortened protein. Frameshifts (from insertions or deletions) scramble every codon after the change.

What is the epigenome, and why are companies interested?

• Chemical changes to chromatin that don't change the DNA sequence: DNA and histone methylation, acetylation, and ncRNAs. These changes affect gene expression.

• They play a role in disease, especially cancer, so companies are developing drugs that target them.

Why is CRISPR-Cas so exciting?

• It's a simple, precise way to target and cut a specific DNA sequence to remove or replace it (genome editing).

• Applications range from research in cells, plants, animals, and bacteria to GM foods and human gene therapy.

• It also shows how basic research (on bacterial immunity) can turn into a life-saving technology.

The human genome has only about 20,000 genes, yet human cells make far more kinds of proteins. How?

• Through alternative splicing. Exons can be joined in different combinations, so one gene can make several mRNAs and proteins.

• About 95% of human genes are alternatively spliced. That's why the early prediction of about 100,000 genes was wrong.

Why is the lagging strand made in pieces while the leading strand is continuous?

• DNA polymerase can only add nucleotides 5′→3′. Because the two strands are antiparallel, the leading strand can be made continuously toward the fork.

• The lagging strand runs the opposite way, so it's made in short Okazaki fragments as the fork opens. DNA ligase then joins them.

Testosterone causes muscle growth but not changes in every gene. Explain how, using enhancers and activators.

• Testosterone binds a receptor inside the cell. The hormone–receptor complex acts as an activator that binds an enhancer called the androgen-response element.

• It turns on only the genes that have that enhancer (for example, muscle and hair-growth genes). Genes without it aren't directly affected.

How does miRNA silence a gene, and why is RNAi useful in biotechnology?

• The miRNA is processed by Dicer into a 21–22 nucleotide strand. It joins a RISC complex, which binds the matching mRNA and either blocks translation or destroys the mRNA.

• RNAi lets scientists switch off a specific gene, both to study it and potentially to silence disease genes. Fire and Mello won the 2006 Nobel Prize for discovering it.

Gene cloning vs recombinant DNA vs genetic engineering

• Gene cloning: making copies of a gene or a piece of one. Example: cloning the insulin gene in a plasmid. A recombinant DNA molecule (containing the gene of interest plus a vector) is introduced into a host cell, such as a bacterium, through a process called transformation. As the bacteria grow and divide, they replicate the foreign DNA alongside their own, producing millions of copies.

• Recombinant DNA technology: combining DNA from different sources. Example: ligating human DNA into a plasmid. Restriction enzymes (molecular scissors) cut a target gene and a carrier vehicle (like a bacterial plasmid), and DNA ligase (molecular glue) seals them together.

• Genetic engineering: changing an organism's genetic makeup. Example: putting that recombinant plasmid into a bacterium. They build on each other: recombinant DNA makes cloning possible, and both are tools for genetic engineering.

Palindrome in AGGCAGTATGGATCCCATTCCG?

• Yes: 5′-GGATCC-3′, paired with 3′-CCTAGG-5′ on the other strand. It is cut by BamHI.

What does DNA ligase do, and how is it different from restriction enzymes?

• Ligase forms phosphodiester bonds that permanently join DNA fragments. The hydrogen bonds between sticky ends alone are too weak to hold them together.

• Restriction enzymes do the opposite: they cut DNA at specific sequences. Restriction enzymes cut, then ligase pastes.

• DNA ligase is essential in a recombinant DNA experiment because it seals separate DNA fragments together to form a single, continuous, and stable recombinant DNA molecule.

Useful features of plasmid vectors, and other vector types

• Features: 

  • origin of replication: specific DNA sequence that allows the plasmid to replicate independently using the host cell’s enzymatic machinery, regulates the plasmid's copy number

  • multiple cloning site: A short segment of DNA containing unique recognition sites for multiple restriction enzymes. This allows researchers to cut the vector and insert foreign DNA without disrupting the plasmid's vital functions

  • selectable markers (ampR, lacZ for blue-white selection): Genes that confer a trait—most commonly antibiotic resistance (e.g., ampicillin or tetracycline resistance) or metabolic markers—allowing researchers to kill off or filter out bacteria that failed to take up the plasmid.

  •  promoters for expression, and sequencing primer sites.

• Other vectors (Table 3.2):

  • phage λ and cosmids: stores larger quantities of DNA than regular plasmid when replacing the non-essential region of phage λ, good for creating Genetic Libraries, while cosmids are even larger, a standard plasmid that has been engineered to contain a cos site from the λ phage, it can be stored in the empty phage heads and essential for transferring entire metabolic pathways or complex eukaryotic genes (which include large non-coding introns) into host cells in a single piece.

  • BACs and YACs (very large inserts, used in genome projects): A BAC is a vector based on the natural F-plasmid (fertility plasmid) found in E. coli bacteria, highly stable as there is only 1 per cell, while YAC is a vector engineered to mimic a real, functional chromosome inside a eukaryotic yeast cell, used for cloning massive eukaryotic genes that include giant non-coding regions (introns)

  • expression vectors: Plasmids equipped with strong promoters (like the T7 promoter), ribosome binding sites, and transcription terminators tailored for active protein production rather than just DNA storage, forcing bacteria like E. coli to transcribe and translate cloned genes to produce therapeutic proteins (e.g., human insulin or growth hormones) or industrial enzymes.

  • Ti plasmids: Large natural plasmids derived from soil bacteria that can naturally transfer a portion of their DNA (the T-DNA) into plant host genomes, create transgenic, pest-resistant, or herbicide-tolerant crops (such as Bt crops or Golden Rice) by replacing tumor-causing genes with beneficial traits

Using a rat gene and PCR to clone the matching human gene

• Design primers from the rat sequence.

• Run PCR on cDNA made from sperm mRNA (using Taq polymerase, dNTPs, and a thermal cycler with the rat-derived primers in a buffer).

• Check product on an agarose gel electrophoresis, extract the band of expected size, ligate the purified PCR product into a cloning or expression plasmid vector containing an antibiotic resistance gene, and transform competent E coli. cells with the recombinant plasmid, select colonies on antibiotic-containing plates

• Confirm it: sequence the PCR product and compare it with the rat gene (for example, with BLAST, looking for high sequence homology). Then use the product as a probe to screen a human testicular cDNA library for the full-length gene.

Copies after 15 cycles, starting from one molecule

• 2¹⁵ = about 32,768 molecules, because each cycle doubles the DNA.

Comparing gene expression in normal vs cancer cells

• Microarrays compare thousands of genes at once. RNA-seq does the same with actual sequence data—measures the entire transcriptome rather than looking at a pre-selected set of genes, allowing discovery of unknown transcripts, novel splice variants, and gene fusions. qPCR works well for checking a smaller number of genes, offers high sensitivity and precision.

Outline of whole-genome sequencing

• Isolate the genome. Cut it into fragments (with restriction enzymes or shearing). Sequence many fragments, usually with NGS. Use bioinformatics software to align the overlapping contigs into complete chromosomes. Then identify genes.

• Some third-generation methods can read long stretches without cutting the DNA into small pieces.

Why NGS and third-generation sequencing advanced genomics

• They are automated and massively parallel, so they are much faster, cheaper, and higher-throughput than Sanger sequencing. Combined with bioinformatics, they have greatly increased the number of genomes sequenced. Third generation sequencing can read even longer fragments at a time, meaning even greater precision. 

Key findings of the Human Genome Project

• About 20,000 genes (not the predicted 100,000, alternative splicing produces many proteins from each gene).

• About 2% of the genome codes for protein, 40% unknown function

• Thousands of disease genes have been mapped.

The "omics" revolution, with two examples

• It means studying a major shift from studying individual genes or proteins one at a time to analyzing all the molecular components of an organism simultaneously.

• Examples: proteomics (all of a cell's proteins), allows researchers to map out the exact structures of disease-associated proteins and design small molecules or monoclonal antibodies that perfectly fit into their active sites, or diagnose certain types of cancer through disease-specific proteins shed into bodily fluids through blood test; transcriptomics (all of a cell's mRNA), used to compare cancer and normal cells for disease biomarkers and during drug R&D to ensure drug doesn’t activate genes associated with toxicity or stress. 

Using personal genomics to diagnose and treat genetic disease

• Sequencing a person's genome or exome finds disease-causing mutations. Treatment can then target that gene at the DNA level (gene therapy or CRISPR), the RNA level (RNAi), or the protein level (targeted drugs). This is precision medicine.

Ethical concerns with personal genomics

• Privacy and who can see your data (insurers, employers, law enforcement);

• anxiety over risk results that aren't certain

• unexpected findings about family members (for example, paternity);

• unequal access because of cost.

Why systems biology matters to companies studying complex disease

• It shows how genes, proteins, and pathways interact as a network, which reveals the key players in diseases like cancer that involve many genes. That helps companies choose drug targets.

What is synthetic biology, and what could it be used for?

• Engineering cells for specific purposes, for example by building synthetic genomes or gene circuits.

• Future uses: microbes that make biofuels/specialized for bioremediation, biosensors that detect and treat disease.

Why is a cDNA library usually better than a genomic library for expressing a human protein in bacteria?

• cDNA is made from mRNA, so it has no introns. Bacteria can't splice introns out, so they can translate cDNA directly.

• A cDNA library also holds only the genes expressed in that tissue, so it's easier to search.

Is your enzyme unique? (public protein database)

• Determine the enzyme's amino acid sequence by mass spectrometry sequencing.

• Search it against a public protein database BLAST for similar sequences, and compare its 3D structure in the Protein Data Bank (PDB).

• No close match, or matches only to proteins with different functions, suggests the enzyme is unique.

A 100°C enzyme created by directed molecular evolution

• Clone the gene for the similar enzyme from the Yellowstone thermophile.

• Mutate the gene to make many variants, express them in a host such as E. coli, and screen for the highest activity at high temperature.

• Take the best variant and repeat the cycle until activity and heat tolerance reach the goal then purify enzymes.

What does the hemocyanin artificial enzyme add to knowledge of 3D structure?

• Enzyme function depends on the 3D placement of a few key active-site residues, here histidines that bind the metal. The rest of the protein mainly holds them in position.

• Place those residues correctly on an artificial scaffold and the activity returns. This confirms that tertiary structure determines function and supports rational design of the kind done, especially of active sites, with Rosetta in David Baker's lab.

Making a patentable DNA sequence from an amino acid sequence

• The genetic code is degenerate: most amino acids have several codons.

• Back-translate the amino acid sequence using different codons than the natural gene, for example codons optimized for E. coli, and leave out the introns.

• The result is a synthetic DNA that codes for the same protein but doesn't occur in nature, so it is patentable.

How can prion research help with Alzheimer's?

• Both are protein misfolding diseases. In Alzheimer's, plaque builds up because brain enzymes can't break down the misfolded protein.

• Prions show how one misfolded protein converts normal proteins and forms a stable, protease-resistant amyloid fold.

• Understanding this could lead to drugs that block conversion and aggregation, early diagnostic tests, and vaccines, such as the tau vaccine.

When are animal bioreactors better than industrial bioreactors?

• Use them when a protein needs mammalian folding and post-translational modifications (like glycosylation, disulfide bonds) that bacteria can't do, and is needed in larger amounts or more cheaply than mammalian cell culture can supply. Cell culture is slow, has complex nutrient needs, and has contamination risks.

• Examples: transgenic milk or eggs, such as ATryn from goats (FDA, 2009), and monoclonal antibodies from fused mouse cells.

Setting up an affinity column for an enzyme

• Attach the enzyme's substrate (or an inhibitor or antibody, a molecule that binds specifically to the enzyme's active site) to the resin beads, which make up the column’s matrix, as the ligand.

• Load the extract which contains the target enzyme, wash out unbound proteins, then use a special buffer (e.g., higher ionic strength) to desorb the pure enzyme.

• If a substrate/inhibitor/antibody isn’t known or easily synthesized, make the target as a fusion protein with a bacterial enzyme whose substrate is on the column.

Separation methods used mainly for analysis, not purification

• HPLC (High-Performance Liquid Chromatography)

• Mass spectrometry

• X-ray crystallography

Using the pI to pick a column

• The pI would tell you the most stable pH for the protein, and whether it had an affinity for a cationic or anionic column matrix, or its relative size for a SEC column.

• At the pI, a protein's net charge is zero. At a buffer pH below the pI it is positive; above it, negative.

• Choose a buffer pH, then choose ion-exchange resin to match: a positive protein binds cation-exchange resin, and a negative protein binds anion-exchange resin.

An economical protein to replace a drug chemical

• Identify the target the chemical binds, then design or evolve a protein (an antibody, peptide, or engineered enzyme) whose binding site has the same 3D shape, using rational design (Rosetta) or directed evolution.

• Produce it in E. coli, B. subtilis, or yeast bioreactors.

Why XNAzymes break down slowly

• XNAzymes are catalysts built from xeno nucleic acids, which have unnatural sugar backbones, not produced by natural evolution. 

• Natural nucleases and proteases evolved to recognize natural shapes, so they don't find sites for catalytic digestion well and degrade XNAzymes slowly. 

How cryo-EM checks a predicted structure

• Flash-freeze the natural protein on a grid and collect many 2D images in different orientations. Software builds a near-atomic 3D structure from them.

• Overlay the predicted model from the amino acid sequence using Rosetta or AlphaFold. Close agreement shows high structural similarity.

Smart bandage: sequences and how it works

• DNA (or mRNA) encoding penicillinase, other enzymes that degrade bacteria, and those that can produce vaccines to infectious agents present in the specific area detected by the embedded sensors e.g., inducible promoters or riboswitches that turn on when bacterial signals are present when the pellet is rehydrated.

Using the yeast two-hybrid system

• Split a transcription factor into its DNA-binding domain and activation domain. Fuse protein of interest to one (the "bait") and a library of cDNA fragments to the other (the "prey") within plasmids, and transform a yeast cell with both.

• If the bait and a prey protein interact, the two domains come together and turn on a reporter gene (color or growth). No reporter signal means no interaction.

Amino acids most likely to undergo PTMs

Histidine and cysteine have available sulfides for this post-translational modification.

Studying a PRNP mutation in mice

• You could raise a group of mice with the PRNP mutation and use a sensitive analysis method (e.g., mass spectrometry) to detect the presence of the unusual protein in brain cells.

Is B. subtilis a good host?

• Check that the protein doesn't need glycosylation, since B. subtilis is a prokaryote and can’t perform this by itself.

• Signal peptides have been identified for the proteins secreted by B. subtilis. You would need to find out if they are produced for your protein of interest so you would know that it would be secreted.

• Express the protein at small scale and measure secreted yield. Check for degradation by the host's own proteases, and confirm folding and activity with SDS-PAGE and an activity assay.

• Scale it up in a bioreactor.

Restoring the target protein after ammonium sulfate

• Ammonium sulfate precipitation is gentle, and the precipitate is relatively stable.

• Redissolve the pellet in cold buffer at the right pH.

• Use dialysis or diafiltration to remove the salt and replace it with a stabilizing buffer, so the protein can fully redissolve into its native, active state.

How multiple attachment sites in ELISA improve detection

• Several enzyme-linked secondary antibodies can bind each primary antibody, so more enzyme means more color per target molecule.

• This amplifies the signal and increases sensitivity, so smaller amounts of protein can be detected.