MMG115 MT1 TopHat

When E. coli cells replicate their genomic DNA, which of the following is responsible for breaking hydrogen bonds between the double-stranded DNA to provide aingle-stranded template?

a) Heat denaturation

b) Primase

c) Toposiomerase

d) Helicase

e) E. coli DNA polymerase

f) DNA ligase

d) Helicase

What would happen if you incubate the DNA fragment as shown below with E. coli DNA polymerase I, dNTP, and Mg⁺⁺ under appropriate temperature and buffer conditions?

5’ - AGCTCGTTAGCCTAGGGTTATA - 3’

3’ - TCGAGCAATC - 5’

5’ - AGCTCGTTAG - 3’

3’ - TCGAGCAATC - 5’

Which of the following is not needed for a PCR reaction?

a) A heat-stable DNA polymerase

b) A pair of primers

c) A template DNA

d) Helicase

e) dNTP

d) Helicase

In real-time PCR, the Ct value is used to calculate the amount of final PCR product.

a) True

b) False

b) False

A restriction enzyme recognizes the sequence shown below which contains rotational symmetry.

5’ - XXXXXX - 3’

3’ - TXGXAX

a) 5’ - ATCATC - 3’ + 3’ - TAGTAG - 5’

b) 5’ - AGCGTA - 3’ + 3’ - TCGCAT - 5’

c) 5’ - AACGTT - 3’ + 3’ - TTGCAA - 5’

c) 5’ - AACGTT - 3’ + 3’ - TTGCAA - 5’

When cloning a eukaryotic gene for expression in a bacterial host like E. coli, why is it necessary to use a version of the gene that lacks introns (such as cDNA)?

a) Bacteria recognize introns as strong termination signals, which stops transcription prematurely

b. Introns contain eukaryotic promoters that are incompatible with bacterial RNA polymerase

c) Bacterial lack the specialized machinery (spliceosomes) required to remove noncoding intervening sequences from pre-mRNA

d) The presence of introns makes the DNA molecule too large to be successfully transformed into a bacterial cell

c) Bacterial lack the specialized machinery (spliceosomes) required to remove noncoding intervening sequences from pre-mRNA

Regarding RNA polymerase, which of the following statements is incorrect?

a) It uses an RNA as template to direct the synthesis of DNA

b) It does not need a primer

c) The new strand is synthesized in the 5’ to 3’ direction

d) It recognizes an appropriate promoter on the template to start transcription

a) It uses an RNA as template to direct the synthesis of DNA

For blue/white screening of recombinant DNA using pUC19 vector, which of the following statements is generally true?

a) White colonies are not ampicillin-resistant

b) Blue colonies are not ampicillin-resistant

c) White colonies has the lacZ’ gene interrupted by a foreign DNA insert

d) Blue colonies has the laxZ’ gene interrupted by a foreign DNA insert

e) Blue colonies has a foreign DNA insert cloned into the multiple cloning sites

c) White colonies has the lacZ’ gene interrupted by a foreign DNA insert

What is a primary advantage of using Gibson Assembly over conventional Restriction Enzyme/Ligation-based cloning?

a) It allows for the assembly of multiple DNA fragments in a single tube without leaving ‘scar’ sequences at the junctions

b) It is the only method that allows for the cloning of blunt-ended DNA fragments

c) It eliminates the need for any sequence homology between the fragments being joined

d) All of the above

a) It allows for the assembly of multiple DNA fragments in a single tube without leaving ‘scar’ sequences at the junctions

Which specific enzymatic activity present in E. coli DNA Polymerase I is removed to generate the Klenow fragment?

a) 5’→3’ exonuclease activity

b) 3’→5’ polymerase activity

c) 3’→5’ exonuclease activity

d) 5’→3’ polymerase activity

a) 5’→3’ exonuclease activity

Removes the N-terminal domain containing 5’ —> 3’ exonuclease activity

What effect does lowering the salt concentration have on a nucleic acid hybridization reaction?

a) It decreases the hybridization stringency.

b) It increases the hybridization stringency.

c) It raises the melting temperature (TmTm​).

d) It promotes annealing of non-complementary strands.

b) It increases the hybridization stringency.

In SYBR Green-based Quantitative PCR (QPCR), how is the presence of non-specific amplification products evaluated at the end of the run?

a) By adding a sequence-specific dual-labeled probe.

b) By performing a dissociation curve analysis.

c) By measuring the fluorescence baseline at cycle zero.

d) By selecting a lower threshold fluorescence level.

b) By performing a dissociation curve analysis.

A melting (dissociation) curve monitors fluorescence loss as temperature rises; multiple peaks indicate non-specific amplicons or primer dimers

Which mechanism enables TaqMan probe-based QPCR to generate a fluorescent signal during target amplification?

a) Cleavage of the dual-labeled probe by Taq 5’→3’exonuclease.

b) Intercalation of reporter dye into double-stranded DNA product.

c) Phosphorylation of the 3’ end of the probe by T4 Kinase.

d) Direct binding of the fluorophore to Taq DNA polymerase.

a) Cleavage of the dual-labeled probe by Taq 5’→3’exonuclease.

As Taq extends the primer, its' 5’-3’ exonuclease activity cleaves the hybridized probe, physically separating reporter from quencher

Why is freshly replicated host genomic DNA in E. coli protected from restriction endonuclease cleavage?

a) It is hemi-methylated, the preferred methylase substrate.

b) It adopts a supercoiled structure blocking digestion.

c) It is bound by single-stranded binding (SSB) proteins.

d) It completely lacks recognition sites for host enzymes.

a) It is hemi-methylated, the preferred methylase substrate.

Two restriction endonucleases recognize the exact same DNA sequence but cleave the phosphodiester backbone at different sites. How are these enzymes categorized?

a) Neoschizomers

b) Isocaudaromers

c) Degenerate enzymes

d) Isoschizomers

a) Neoschizomers

Under sub-optimal reaction conditions such as low salt or high enzyme concentration, EcoRI exhibits 'star activity'. What is the direct consequence of star activity?

a) Irreversible inhibition of ligase activity.

b) Removal of 5’ terminal phosphate groups.

c) Cleavage at non-canonical sequence sites.

d) Conversion of sticky ends into blunt ends.

c) Cleavage at non-canonical sequence sites.

Star activity alters enzyme specificity, causing non-specific cleavage at sequence sites that differ from the canonical consensus sequence

Why is T4 DNA Ligase, rather than E. coli DNA Ligase, required when joining two blunt-ended DNA fragments?

a) E. coli DNA Ligase cleaves single-stranded overhangs.

b) T4 DNA Ligase fills in single-stranded gaps prior to ligation.

c) T4 DNA Ligase operates without requiring ATP cofactors.

d) E. coli DNA Ligase cannot efficiently ligate blunt ends.

d) E. coli DNA Ligase cannot efficiently ligate blunt ends.

Why is RNA inherently less chemically stable than DNA under physiological conditions?

a) Uracil bases form weaker hydrogen bonds than thymine.

b) The 2’−OH group makes RNA prone to self-hydrolysis.

c) RNA backbones carry double the negative charge of DNA.

d) The single-stranded structure prevents base stacking.

b) The 2’−OH group makes RNA prone to self-hydrolysis.

The nucleophilic 2’-OH group on the ribose ring can attack the adjacent phosphodiester bond, making RNA susceptible to alkaline and enzymatic hydrolysis

Why is IPTG used instead of allolactose for inducing gene expression in Lac-inducible bacterial expression systems?

a) IPTG is non-metabolizable, maintaining constant induction.

b) IPTG permanently mutates the lacOlacO operator sequence.

c) IPTG binds directly to RNA polymerase to activate transcription.

d) IPTG prevents eukaryotic mRNA 5′5′ capping degradation.

a) IPTG is non-metabolizable, maintaining constant induction.