EXAM #2 | CRM 314-001 | Missouri State University | Study Guide (may be incomplete)

Test Question - Which lineage is mtDNA is identical in the paternal lineage? (T/F)

False (its the MATERNAL lineage that all mtDNA is identical)

Test Question - What Supreme Court case set the minimum standard for the admissibility of scientific evidence in court? (Multiple Choice)

A. Korematsu v. United States

B. Plessy v. Ferguson

C. Daubert v. Merrell Dow Pharmaceuticals

D. Mapp v. Ohio

C (not much to this, just know it)

Test Question - What is the difference between a blind sample an double blind sample? (Short Answer)

A blind sample is given by a supervisor to ensure the forensic technician's work is acceptable.

A double blind sample is given by an outside source to test the agency as a whole, meaning not even the supervisor knows what the sample is. These are used to ensure the quality of work from the ENTIRE lab.

Test Question - All forensic science techniques were developed from traditional scientific disciplines (i.e. biology, chem, and physics) at universities? (T/F)

True

Test Question - Research regarding forensic techniques is not necessary in order to determine reliability? (T/F)

False

Not really a question, just know what dry-labbing is.

Dry-labbing is when you don't test for something AT ALL due to how confident you are, eye-testing, and other stuff like that. Basically, you just didn't go though the formal process you should have.

Test Question - Serology includes the study of hair? (T/F)

False (serology is the study and examination of body fluids, such as blood. The study of hair is known as morphology)

Test Question - Saliva can be detected for up to 28 months? (T/F)

True (it lasts a LONG time)

Test Question - Semen collected at a crime scene is always individual characteristic evidence? (T/F)

False (it's a class characteristic. the sperm is what we're looking for as that determines individuality)

Test Question - Blood typing is a measure of certain antibodies on the surface of red blood cells? (T/F)

True (it tells you what type of blood you have)

Test Question - Luminol is a presumptive test for blood? (T/F)

True (a presumptive test is done in the field while a confirmatory test is done in the lab. luminol can help you quickly determine if what your looking at is blood)

Test Question - The direction of the bloodstain pictured in the bottom right most image is 12 o'clock? (T/F)

False (since the thin part is pointing down, it's direction would be 6 o'clock)

Test Question - Forensic serology can be defined as the examination and analysis of hair? (T/F)

False (serology is the study of body fluids, such as blood, not hair)

Test Question - The angle of impact of a blood spatter is calculated as: length/width * sin? (T/F)

False (this is tricky, but the correct formula is: width/length x sin^-1)

Test Question - The degree of impact is associated with a circular shape of a blood stain is 45 degrees? (T/F)

False (when you drop a bit of water that falls vertically, it will create a near circular shape, while the more acute the angle, the more oval it will be. For this question specifically, the correct answer would be 90 degrees)

Test Question - What type of blood spatter pattern will a gunshot produce? (Multiple Choice)

A. Mist-like

B. Castoff

C. Spraying

A (a gunshot produces a mist like pattern of blood spatter. its like a squeezing a spray bottle almost)

Test Question - What type of blood spatter pattern will a impact (beating/stabbing) produce? (Multiple Choice)

A. Mist-like

B. Castoff

C. Spraying

B (you ever have a wet hand and doing a sort of throwing motion at a friend and it leaves a distinct trail of water? that's literally what this is but with blood)

Test Question - What type of blood spatter pattern will a breach of an artery produce? (Multiple Choice)

A. Mist-like

B. Castoff

C. Spraying

C (this is a VERY messy type of blood spatter pattern. blood will gush absolutely everywhere, like throwing a bucket of water on the wall)

Test Question - Direction of travel/directionality of a blood stain is determined by: (Multiple Choice)

A. The relative location of the blood source in a two-dimensional perspective.

B. The narrow end of an elongated bloodstain.

C. The location of the blood source in a three-dimensional perspective.

D. The mathematical relationship between the width and length of an elliptical bloodstain.

B

Test Question - Regarding a blood spatter pattern, the area of convergence is. (Multiple Choice)

A. The relative location of the blood source in a two-dimensional perspective.

B. The narrow end of an elongated bloodstain.

C. The location of the blood source in a three-dimensional perspective.

D. The mathematical relationship between the width and length of an elliptical bloodstain.

A (remember that convergence refers to where stuff intersects on a 2D plane)

Test Question - Regarding a blood spatter pattern, the angle of impact is. (Multiple Choice)

A. The relative location of the blood source in a two-dimensional perspective.

B. The narrow end of an elongated bloodstain.

C. The location of the blood source in a three-dimensional perspective.

D. The mathematical relationship between the width and length of an elliptical bloodstain.

D (again, this is width/length * sin^-1)

Test Question - Regarding a blood spatter pattern, the area of origin is. (Multiple Choice)

A. The relative location of the blood source in a two-dimensional perspective.

B. The narrow end of an elongated bloodstain.

C. The location of the blood source in a three-dimensional perspective.

D. The mathematical relationship between the width and length of an elliptical bloodstain.

C (remember that origin refers to the source of the blood in a 3D space)

Test Question - The most common methods used for presumptive blood tests are Kastle-Meyer and Hemastix? (T/F)

True (these can be used to determine if a substance is blood based on the presence of a color change in the strip)

Test Question - One of the most common staining techniques used to distinguish sperm cells from other material is called the press test? (T/F)

False (the correct answer is Christmas Tree Stain. it has a very distinct red and green color)

Test Question - DNA is found in structures called chromosomes? (T/F)

True

Test Question - The characteristics we inherited from our parents are encoded in our genes? (T/F)

True

Test Question - Name the 4 base nucleotides. (Short Answer)

A, T, G, C

Test Question - What base pairs do A and G pair to? (Short Answer)

A to T,

G to C

Test Question - mtDNA is nearly identical across all your maternal lineage? (T/F)

True (for some reason, your mitochondrial DNA is pretty much the same across all females in a family tree in the sense of it being like daughter, mother, grandmother, great-grandmother, etc.)

Test Question - What is STR short for? (Short Answer)

Short Tandem Repeat

Test Question - Two alleles who share the same number of repeats are referred to as what? Different number of repeats? (Short Answer)

Homozygous - Same number

Heterozygous - Different number

Test Question - Coding DNA is identical in most people? (T/F)

True

Test Question - STRs are segments of _________ DNA used for forensic analysis? (Multiple Choice)

A. Coding

B. Non-Coding

Non-Coding

Test Question - How many Loci have been selected as the standard for DNA typing? (Short Answer)

13

Test Question - The name of the loci AMEL indicates that it is not located within a gene? (T/F)

False

Test Question - The name of a loci not found on a gene uses which naming scheme? (Multiple Choice)

A. H12P138

B. V7R892

C. D3S120

D. K12T889

C (loci that are not specifically named, meaning they are not located within a gene, are given the naming scheme D[chromosome number] S [location number])

Test Question - The following alleles are homozygous? (T/F)

AATCAATCAATCAATCAATC

AAGCAAGCAAGCAAGC

False (these are heterozygous, meaning they are different)

Test Question - What are all the possible STR allele combinations that a child could inherent from from a specific locus given the following? (Short Answer)

Mother - 5, 6 (Heterozygous)

Father - 8 (Homozygous)

5, 8

6, 8

(since the mother is heterozygous, she can give either a 5 or 6 or their child. since the father is homozygous, he can only give an 8. due to this, the only possible combinations using a punnett square are 5, 8 and 6, 8

Test Question - What is the most common method of collecting DNA samples? (Multiple Choice)

A. Buccal Swab

B. Clayton Swab

C. Truett Swab

D. Burl Swab

Buccal Swab (gottem)

this isn't a question, just be able to read an electropherogram

"answer here or something idk here's a picture :)"

not a question, but be able to read and know this stuff here

ooooo look a picture :3

Test Question - How many atoms are located in the first shell of an Osmium atom? (Short Answer)

2 (...remember its only 2 for the first shell)

Test Question - How many electrons are shared in the chemical compound CO2? (Short Answer)

8 (this is a weird one, literally just watch some lewis structure videos idk man i have a hard time with it too)

Test Question - What are the 3 main types of fingerprints? (Short Answer)

Arches, Loops, and Whorls

Test Question - Among the 3 main types of fingerprints, what are the sub-categories associated with each print? (Short Answer)

Arches - Plain, Tented

Loops - Ulnar, Radial

Whorls - Plain Whorl, Double, Accidental, and Central Pocket

Test Question - For instance, if you left a fingerprint on a surface using your left index finger and it was a loop that opened to the right, what type of sub-fingerprint would that be? (Multiple Choice)

A. Radial Loop

B. Ulnar Loop

A (the radial bone is on the inside of the arm while the ulnar is on the outside. with this, a loop opening towards the stomach is always radial while a loop opening towards the pinky is always ulnar)

Test Question - The modified __________ system as used in the United States is a scheme for the classification of 10-print sets, or a fingerprint card, for one individual. (Multiple Choice)

A. Lewis System

B. Harris System

C. Felix System

D. Henry System

D (this is legit just one to memorize, nothing else)

Test Question - What is the empirical approach as it relates to fingerprint analysis? What about the holistic approach? (Short Answer)

In the empirical approach, there is a set number of minutiae needed to confirm two fingerprints to each other. This is what other countries use.

In the holistic goes based off the quality and quantity of the minutiae. This is what the US uses.

Test Question - What are the most common and least common types of fingerprints? (Short Answer)

Most Common - Loops with 60-65%

Least Common - Arches with 5%

The other is whorls with 30-35%

Test Question - What types of minutiae are there? (Short Answer)

Bifurcations, Endings, Dots, Islands, Enclosure, Core, Delta

Test Question - What does AFIS stand for? (Multiple Choice)

A. Advanced Facial Identification System

B. Adaptive Fraud Inspection Suite

C. Automated Fingerprint Identification System

D. Advanced Framework for Integrated Services

Automated Fingerprint Identification System (just know this bruh)

Test Question - What type of print leaves a 3D impression? (Multiple Choice)

A. Patent Print

B. Plastic Print

C. Latent Print

D. Digital Print

B (plastic leave a physical impression, patent are legit just visible by default gang, and latent need more processing to be seen)

Test Question - Fingerprints are not a type of biometric identifier? (T/F)

False (dude, yes they are. bio means life and we are alive n' stuff)

Test Question - How is superglue useful in processing latent prints? (Short Answer)

If you heat it up, the superglue vapors will adhere to the fingerprint oils, making them visible.

Test Question - Radial cracks are the lines that propagate outwards from where the bullet seemingly hit? (T/F)

True (they're kind of like the straight lines that go away from the center, similar to a highway on a map if you ever seen that)

Test Question - Concentric Cracks are the circular cracks that form around where the bullet seemingly hit? (T/F)

True (these are the circular cracks that from around where it looks like the bullet hit)

Test Question - What is morphology? (Multiple Choice)

A. The study of body fluids.

B. The study of toxins.

C. The study of hair.

D. The study of blood.

C (Don't confuse this with serology, which is the study of bodily fluids. They kind of sound similar to be fair though)

Test Question - Where can DNA be obtained from a human hair? (Multiple Choice)

A. The Cuticle

B. The Medulla

C. The Spinous

D. The Root

D (when a hair is pulled from the root, it is possible to obtain DNA if that hair is in the anagen phase)

How many protons are contained in the nucleus of a carbon atom?

6

what is the average atomic mass of carbon

12.011

How many electrons are located in the first shell of a carbon atom?

2

How many electrons are located in the second shell of a carbon atom?

4

What elements and how many of each is this chemical compound K2CO3 (Potasium Carbonate) made up of?

2 potassium, 1 carbon, and 3 oxygen