Bio 011 Midterm II

How does cAMP-CAP binding its target DNA sequence (the CAP site) affect lac operon transcription?

It enhances RNA polymerase binding to the promoter and increases the rate of transcription

How is the lac operon affected by negative control?

 

The lac repressor binds to the operator in the absence of lactose.

To produce multiple proteins from a polycistronic mRNA, each translated region must have:

a ribosome binding site, a start codon, a stop codon

A mutation in the E. coli lacI gene causes expression of a Lac Repressor that cannot bind to its DNA target (the Operator). What would happen at the lac operon in this mutant when there is No Lactose and High Glucose?

low levels of lac operon transcription

A common feature of all eukaryotic "core promoters" is:

 

a "TATA" sequence recognized by TFIID

Regulatory DNA elements that function to increase transcription levels in eukaryotes are called 

 

enhancers

The collagen gene is transcribed in fibroblast cells but is never transcribed in neurons. This differential transcription could be regulated by:

A transcription activator that is only expressed in fibroblasts and binds to an enhancer sequence in the collagen promoter.

The mediator protein complex in eukaryotes

facilitates interactions between RNA polymerase II and regulatory transcription factors.

What is a major component of chromatin?

 

Histones are a major component of chromatin

Chromatin remodelers can:

change the spacing between nucleosomes, so that more DNA is accessible to transcription factors

How many nucleotides are contained in a single codon?

Three

How many tRNAs will be used to translate this mRNA sequence into a polypeptide?

5’ CCGAAUAUGUUUCCCGAAUAACGAGGG 3’

NOTE: this is the entire mRNA sequence, from 5’ end to 3’ end.

4

Which of the following in NOT a property of the genetic code?

It determines the rate of transcription.

Which of the following is not involved in the initiation of translation?

RNA polymerase

Formation of a peptide bond during translation elongation is catalyzed by:

Ribozyme activity of the ribosomal RNA

What recognizes the codons UAA, UAG, UGA in the ribosome "A" site?

release factor protein

A difference between bacterial and eukaryotic translation is

modifications to the 5’ end of mRNA are required for ribosome binding only in eukaryotes

RNA interference (miRNAs and siRNAs) is a mechanism for silencing gene expression at the:

post-transcriptional (after transcription) but pre-translational (before translation) level

To which of the following types of molecules could an non-coding RNA (ncRNA) bind?

 

ncRNA can bind to all of these types of molecules

Which of the following is NOT a general function of an non-coding RNA (ncRNA)?

 

encoding a polypeptide

What are the four criteria that genetic material must fulfill? 

Contain information

Be copied or replicated

Be transmitted from generation to generation.

Contain variation

What is meant by the description "antiparallel" regarding the strands that make up DNA?

The 5' to 3' direction of one strand runs counter to the 5' to 3' direction of the other strand.

Rosalind Franklin's important contribution to solving the structure of DNA was:

 

X-Ray diffraction data

Why is the lagging strand synthesized in a discontinuous fashion (multiple RNA primers and Okazaki fragments)?

DNA synthesis only occurs in a 5' to 3' direction, which causes lagging strand synthesis to “restart” as new 3’ regions of template DNA become available

is NOT required for Leading strand DNA synthesis?

DNA ligase

What happens to RNA primers during DNA replication?

A DNA polymerase removes the RNA primer and replaces it with DNA

best describes the function of telomerase at the telomere?

It adds new DNA to the 3’ end of the template strand of DNA

What is the complementary sequence to the DNA strand  3' - ATTCGGTGA - 5'

5' - TAAGCCACT - 3'

The process that produces mRNA from DNA is called

transcription

Which of the following types of RNA is NOT produced in bacteria?

pre-mRNA

What is the complementary sequence of 5’ - GCGAT - 3’

5’- ATCGC - 3’

1. What is true about Leading Strand vs. lagging strand DNA synthesis is TRUE

Leading strand synthesis only requires a single RNA primer to start. Lagging strand synthesis requires multiple RNA primers.

RNA processing in eukaryotes (5’ Cap additions, splicing, polyA tail addition), occurs:

In the nucleus

1. What mRNA will be transcribed from this DNA?

   1. 5’ C C G G A T G C A T T A G T T T 3’ - Coding strand

   2. 3’ G G C C T A C G T A A T C A A A 5’ - Template strand

5’ C C G G A U G C A U U A G U U U 3’ -

What Codon does this tRNA “decode” ( G G C)

5’ C C G 3’

At the beginning of each round of Translation Elongation what best describes tRNA in in the A site:

The tRNA has a single amino acid attached to it.

Where is gene regulation occurring in the prokaryotes (bacteria) and eukaryotes?

In prokaryotes, gene regulation is mainly at the transcriptional level in the cytoplasm, while in eukaryotes it occurs at multiple stages — from chromatin structure in the nucleus to post‑translational modifications in the cytoplasm. 

High presence lactose and Glucose

High presence lactose and Glucose

A mutation in a gene in the fruit fly was found to affect eye color. The relevant protein is normal in its molecular weight and amino acid sequence, although much less of the protein is made in mutant files. A reasonable explanation for the change in levels of protein is that the mutation:

Is in the core promoter of the genes

What is the function of chromatin remodelers?

They can change the spacing between nucleosomes, so that more DNA is accessible to transcriptional factors

How could this cell type-specific gene expression occur?

Transcription factors that activate collagen gene transcription are only present in Fibroblasts

The following sequence of DNA is part of the coding sequence of a normal, wild-type gene. 5' ATG CGG GTA GTT AGC CGA TAG 3' A deletion occurs during DNA replication, causing the underlined guanine (also shown in red) to be removed from the nucleotide strand. What effect is this most likely to have on the final protein? The following sequence of DNA is part of the coding sequence of a normal, wild-type gene. 5' ATG CGG GTA GTT AGC CGA TAG 3' A deletion occurs during DNA replication, causing the underlined guanine (also shown in red) to be removed from the nucleotide strand. What effect is this most likely to have on the final protein?

It will cause a frameshift that results in a premature stop codon and a truncated protein

DNA polymerase uses which activity to remove a mismatched base pair

3’ - 5’ exonuclease

Chromatin-remodeling complexes can:

Change nucleosome position

remove histones

replace histones

Remodelers are recruited genes by

transcription factors

histone modifications

DNA is wrapped around histone proteins to form

Nucleosomes

Eukaryotic genes are usually flanked by

nucleosome-free regions

Chromatin remodeling complexes

change the positions of compositions of nucleosomes

If all cells of an organism are genetically equivalent, many factors control gene expression via

combinational control

TATA box determines

the starting site for transcription

RNA polymerase interacts with many activators and repressors which bind to

enhancers or silencer sequences