Chapter 8 Microbial Genetics and Genetic Engineering

Chromosome

tightly coiled bodies in cells that are the primary sites of genes

gene

site on chromosome that provides info for a certain cell function

specific segment of DNA that contains the necessary code to make a protein or RNA molecule

genotype

the genetic makeup of an organism

responsible for an organism phenotype or expressed characteristics

phenotype

observable characteristics of an organism produced by the interaction between its genetic potential (genotype) and the environment

ribose

5 carbon monosaccharide found in RNA

deoxyribose

5 carbon sugar that is an important component of DNA

purine

nitrogen base that is an important encoding component of DNA and RNA

ex) adenine and guanine

pyrimidine

nitrogen bases that help form the genetic code on DNA and RNA

ex) uracil, thymine, and cytosine

semiconservative replication

in DNA replication, synthesis of paried daughter strands, each retaining a parent strand template

lagging strand

strand of new DNA that must be synthesized in short segments (5 to 3)

later sealed together to form a strand in the 3 to 5 direction

leading strand

The strand of new DNA that is synthesized continuously in a 5′ to 3′ direction

okazaki fragments

short segments of DNA synthesized in a 5 to 3 direction which are then sealed together to form the 3 to 5 strand

ligase

enzyme

required to seal the sticky ends of DNA pieces after splicing

transcription

mRNA synthesis

process by which a strand of RNA is produced against a DNA template

translation

protein synthesis; process of decoding the mRNA code into a polypepetide

(2% of the genome encodes for mRNA that is translated into proteins)

codon

A series of triplet bases that hold the message of the transcribed mRNA

wobble base

Only the first two nucleotides are required to encode the correct amino acid

The third nucleotide does not change its sense

Permits some variation or mutation without altering the message

operon

genetic operational unit that regulates metabolism by controlling mRNA production

In sequence, the unit consists of a regulatory gene, inducer or repressor contorl sites, and structural genes

only found in bacteria and archaea

regulator

composed of the gene that codes for the repressor, a protein capable of repressing the operon

repressor

protein product of a repressor gene that combines w the operator and arrest the transcription and translation of structural genes

promoter

part of operon sequence

DNA segment that is recognized by RNA polymerase as the starting site for transcription

operator

acts as an on/off switch for transcription

mutation

permanent change in nucleic acid sequence of organisms genome

mutagens

agent that induces genetic mutation

ex) certains chems, UV light, radioactivity

point mutation

addition, deletion, or subsitution of single bases

missense mutation

any change in the code that leads to the placement of a different AA

can create a nonfunc protein

can produce a protein that functions differently

can cause no significant alteration

nonsense mutation

changes a normal mutation into a stop codon

silent mutation

alters a base, but does not change the AA, and has no effect

frameshift mutation

one or more bases are inserted or deleted

changes the reading frame of the mRNA

nearly always results in a nonfunctional protein

single nucleotide polymorphism (SNP)

only a single nucleotide is altered

passed on genetically

difference among those carrying mutation and those that do not

identification is critical for personalized medicine

genomics

systematic study of an organism’s genes and their functions

proteomics

study of an organism’s complement of proteins and functions mediated by the proteins

transcriptomics

study of transcriptome

• complete set of RNA transcripts produced by the genome

horizontal gene transfer

any transfer of DNA that results in organisms acquiring new genes that did not come directly from parent organisms

conjugation

contact between donor and recipient cells associated w the tranfer of genetic material such as plasmids

can involve special (sex) pili

also a form of sexual recombination in ciliated protozoa

transformation

nonspecific acceptance by bacterial cell of small fragments DNA from the environment

facilitated by DNA binding proteins on the cell wall

transduction

transfer of genetic material from one bacterium to another by means of a bacteriophage vector

What are the processes between each? What enzymes are used in each process?

What are the differences between DNA and RNA? How can you recognize RNA from DNA?

Similarities:

both made of nucleotides

5 carbon sugar, phosphate group, nitrogenous base

Adenine, cytosine, guanine

sugar phosphate backbone

Differences:

DNA:

• double stranded

• deoxyribose

• Thymine (pairs with A)

• antiparallel (5 to 3 in 1 direction and 3 to 5 in the other)

RNA

• single stranded

• ribose

• uracil (pairs with A)

What are the five nucleotide bases? Which one is in RNA only?

Adenine + thymine

Guanine + Cytosine

A and G are purines

T and C are pyrimidines

Uracil (paired w A and a pyrimidine)

Which direction on the DNA strand does DNA Polymerase move? What direction is the new strand assembled?

DNA polymerase: 3 to 5

New strand: 5 to 3

Build the complementary strand of DNA:

5' GTACTGAACCGTATGTCCATGTCATAATGTACCGATC 3

On the above draw in which direction RNA polymerase would move (use either strand)

←—- (template strand reading)

Which direction on the DNA strand does RNA Polymerase move? What direction is the new strand assembled?

RNA polymerase moves: 3 to 5

New strand: 5 to 3

Describe the function of mRNA, tRNA and rRNA

mRNA: transcript of a structural gene or genes in the DNA

• transports DNA master code to the ribosome

tRNA: contains sequences of bases that form hydrogen bonds w complementary sections of the same tRNA strand

• brings AAs to ribosome during translation

rRNA: forms the major part of a ribosome and participates in protein synthesis

Given the following strand of DNA, label the coding strand, the template strand and build the RNA. Of the RNA find the start codon, underline each codon following, identify the amino acids that would be produced, and identify the stop codon. How many amino acids would be produced from this strand of RNA?

3` ATTATACTTCGTTGACGCGTCCCCCCATGGTATCCGTG-5`

template: 3ATTATACTTCGTTGACGCGTCCCCCCATGGTATCCGTG-5`

coding: 5’ UAAU(AUG)(AAG)(CAA)(CUG)(CGC)(AGG)(GGG)(GUA)(CCA)(UAG)GCAC 3’

AUG= start

AAG = Lys CAA = Gin CUG = Leu AGG= Arg GGG= Gly GUA= Val CCA = Pro UAG= stop

Describe substrate induction utilizing the Lac operon

process by which a cell initiates the transcription of genes required to metabolize an alternative sugar—lactose—only when that specific substrate is present in the environment

Describe Feedback Inhibition utilizing the Arginine operon

negative feedback mechanism acts as a cellular thermostat to prevent the wasteful production of the AA arginine when it is already abundant

Conjugation – How does it work, relevance to human health

mode of genetic exchange in whihc a plasmid or other genetic material is transferred by a donor to a recipient cell via direct connection

health:

• drug resistance

• resistance to metals

• toxin production

• enzymes

• adherence molecules

Transformation– How does it work, relevance to human health

the transfer of genetic material contained in “naked” DNA fragments from a donor cell to a competent recipient cell

health:

• polysaccharide capsule

• unlimited w cloning techniques

Transduction- How does it work, relevance to human health

transfer of genetic material from one bacterium to another by means of bacteriophage vector

health:

• toxins

• enzymes for sugar fermentation

• drug resistance

How do mutations occur?

Spontaneous

• random change in DNA arising from errors in replication

Induced

• results from exposure to known mutagens, physical or chem agents that disrupt DNA

  • Radiation: UV light, Xray

  • chemicals: nitrous acid

How frequently do mutations occur?

1 in a billion bases

Advantages of mutations? disadvantages?

advantages:

• can allow organism to survive and reproduce

• adaptation and evolution

disadvatages:

• genetic disorders

• increased cancer risk

• drug resistance in bacteria

Restriction endonucleases and palindromes uses in technology?

Restriction Endonucleases:

• enzymes capable of recognizing foreign DNA and breaking the phosphodiester bonds between adjacent nucleotides on both strands of DNA

• protects bacteria against incompatible DNA of bacteriophages or plasmids

• allows biotechnologists to cleave DNA at desired sites

• necessary for recombinant DNA tech

• recognize and clip at palindromes

  • sequences of DNA that are identical when read from the 5 to 3 direction on one strand and the 5 to 3 direction on the other strand

Polymerase chain reaction what natural process does it resemble? What are its uses?

resembles DNA replication

rapidly increases amount of DNA in sample w/o the need for making cultures or carrying out complex purification techniques

sensitivity allows for:

• can detect cancer from single cell

• diagnose an infection from single gene copy

Gel electrophoresis uses in crime and paternity?

separates DNA fragments by size using an electrical current

produces DNA fragments of different lengths

samples placed in soft agar gel and subjected to an electrical current

phosphate groups have (-) charge which causes DNA to move toward the positive pole in the gel

larger fragments migrate more slowly and smaller migrates quickly

• position of fragments is determined by staining the gel

Crime:

• identifying suspects

• victim identification

Paternity:

• comparing the DNA bands of the child to the mother and potential fathers

• the bands that do not match mother has to come from the father

DNA sequencing uses?

give exact order of bases in a plasmid, chromosome or entire genome

slide 107 for exact procedures

can identify irregularities, frameshifts, and ambiguities

Future therapies using gene therapy, CRISPR?

Gene therapy: replacing a faulty gene responsible for disease w a gene from a healthy organism

CRISPR: allows scientists to cut an organism’s DNA in any chosen location and fix a DNA defect