Biol 304 Discussion 10

What is the difference between attached ribosomes and free ribosomes?

Free ribosomes make proteins that will stay inside the cell

Attached ribosomes make proteins that will leave the cell or be used in the cell membrane

What is the function of a ribosome?

To synthesize proteins

Do all organisms have ribosomal RNA (rRNA)?

Yes

What are the different "sites" on ribosome?

E, P, A

What is the difference between peptidyl-tRNA and amino-tRNA?

amino-tRNA has one amino acid on them

peptidyl-tRNA has multiple amino acids

What are the ends of the polypeptide called?

N-term and C-term

What are the different start codons that are recognized?

AUG UUG GUG

What amino acid do start codons encode?

Met

What are the different tRNAs that carry methionine?

tRNAf, tRNAi, tRNAm

Why would eIFs bind both the 5' cap and the PABP in eukaryotes?

It creates a loop for efficiency

What does RF stand for?

Release Factor: involved in termination of translation

Why are there different release factors such as RF1 and RF2?

What does RF3 do?**

What does RRF do?**

RF1: UAA UAG

RF2: UAA UGA

RF3: catalyzes the release of the peptide chain out

RRF: Ribosome Recycling Factor

If one is referring to a codon, what molecule is he or she referring to?

mRNA

If one is referring to an anticodon, what molecule is he or she referring to?

tRNA

Why do we say that the genetic code is nearly universal? What are examples of deviations? How do they arise?

Almost all organisms use the same aa or code

Examples are some lower organisms, like Ciliates using the UAG and UAA codons for glutamine instead of a STOP.

Mutations

Which factors bind the "A" site?

initiation: IF1

elongation: EF-Tu / aa-tRNA / GTP

termination: RF1/RF2, RF3, and RRF

In the given DNA template strand, the bold characters indicate the sequence that will be expressed. What would be the corresponding DNA message strand, mRNA, and protein in prokaryotes?

3'-CGGAT TACCGATGCATTGA TGAAAAA-5' template DNA

DNA message: 5' ATGGCTACGTAACT 3'

mRNA: 5' AUGGCUACGUAACU 3'

proteins: N-f-Met-Alanine-Threonine-C

When given the following DNA message sequence, what would be the corresponding DNA template strand, mRNA codon, tRNA anticodon, and amino acid?

5'-GTG-3' DNA message

DNA template: 3' CAC 5'

codon: 5' GUG 3'

anticodon: 3' CAC 5' (OR 3’-CAU-5’ DUE TO WOBBLE EFFECT)

amino acids: valine

When given the following tRNA anticodon, what would be the sequence of the corresponding DNA message and template strands, mRNA codon, and amino acid?

3'-AUU-5' Anticodon

DNA message: 5' TAA 3'

DNA template: 3' ATT 5'

codon: 5' UAA 3'

amino acid: STOP

A retrovirus infects a eukaryotic cell. It injects a (+) strand RNA. This virus has an IRES site and it does not require a cap for initiation. The bold region represents the (+) strand RNA of the virus. Find the (+) and (-) DNA strands, the mRNA that is transcribed, and the protein sequence.

5'-R-U5-GU GAUGACAUGCGGAAAACGUACAUAGCGU AU-U3-R-3'

Question 24

Question 25

How many codons are there? Why? How many of these encode amino acids?

64, because it's 4^3 (4 possible codons for 3 different positions). 61 code for amino acids (the other 3 are STOP codons)

Which amino acids have only one codon?

methionine and tryptophan

Which amino acids have six codons?

leucine, serine, arginine

What does third base degeneracy mean? What is the third base referring to? Which base might be irrelevant in the anticodon?

• 3rd base is sometimes irrelevant

• the last position, 3’ on the mRNA codon

• 1st base (in the 5’ to 3’ direction)

What is the wobble effect? Can binding occur if the third base of the codon is G and the first of the anticodon is U? Can binding occur if the third base of the codon is U and the first of the anticodon is G? Can binding occur if the first base of the codon is G and the third base of the anticodon is U?

Wobble effect is when one tRNA can recognize many codons (even w/ incorrect paiting)
Yes.

Yes.

No.

What post-transcriptional modifications happen to mRNA? What post-transcriptional modifications happen to tRNA?

mRNA: poly(A) tail, 5' G-cap, intron splicing

tRNA: ends are trimmed, introns removed, D-loop forms by turning U into D, adding CCA. base modifications: (ψ: pseudouridine D: dihydrouridine) SPECIAL NUCLEOTIDES!

Which RNA polymerase transcribes tRNA?

RNA pol III

What is the loop and stem of tRNA collectively called?

Arms

To which end of the tRNA is the amino acid attached?

3' CCA (sequence of acceptor site on tRNA)

Which functional group of an amino acid is attached to tRNA?

carboxyl group

What does ψ and D stand for?

ψ: pseudouridine

D: dihydrouridine

Why can "wobble" occur?

the loop in tRNA allows for flexibility

Translation

• what is it?

• stages?

• protein synthesis RNA (nt) → protein (aa)

• initiation (highly regulated), elongation, termination

Prokaryotic Stages of Translation: Initiation

pg 137

1. IF-3 binds to 30s to stabilize subunit

2. 1F-2 and IF-1 are recruied
   - IF-1 binds to A to prevent charged t-RNAs from entering the site
   - IF-2 recruits 1st charged tRNA (f-met) into the P site
   > process is GTP dependent and binding of f-met causes the releases of GDP
   > NOTE: first aa binds to the p site and any other aa following will bind to the A site

3. IF-1 and IF-3 leave and 50s subunit joins 30 subunit (when connected creates the 70S initiation complex)
   
   

Prokaryotic / Eukaryotic Stages of Translation: Elongation

pg 137

1. EF-Tu / eEF1alpha will bring in charged t-RNA into A site (GTP dependent process)

2. Peptide bond is formed by Peptidyl transferase (in the 23S rRNA)

3. EF-G will bind to the A site and help mediate translocation of charged and uncharged t-RNAs into E & P site

4. 2 shifts

5. When EF-G is done
   - there is an open A site
   - P site has a new tRNA with growing chain

6. Old uncharged tRNA exists from E site

Prokaryotic/Eukaryotic Stages of Translation: Termination***!

pg 137

1. Ribosome will hit a stop codon (no tRNA for STOPs)

2. RF1 and RF2 will recognize stop codon

3. RF3 will bind and cause the release of the polypeptide chain

4. RRF will bind and cause a dissociation of large and small subunit

in eukaryotes the tRNA uses the exist site

Eukaryotic Initiation

What complex is involved? What are its components? What are they bound to?

• 43S pre-initiation complex

  • eIF1, eIF1a, eIF2, eIF3, Met-tRNAi

  • eIF2 bound to Met-tRNAi

Eukaryotic Initiation Steps

why circularize?

• Cap binding complex

  • mRNA, eIF4A, B, E, and G

• 43S binds to 5’ end of mRNA

• 48S complex forms at initiation codon

  • eIF2, eIF3, eIF1, eIF1A, eIF4A, eIF4B, and eIF4

  • scans the 5’ for the first AUG in context

  • context: —NNPuNNAUGG

Why circularize?

• to increase efficiency of reinitiation of ribosome

translation comparison prok vs euk

pg 136

tRNA Structure

• carries aa into ribosomes

• stem-loop regions of dsRNA (arms) that form 3D upside L-shaped tRNA

post translational modifications to pre-tRNA

• introns removed

• 5’ end trimmed

• 3’ end added with 5’-CCA-3’

• base modifications

wobble effect is what? show table of codon anticodon binding

binding between 3’ (3rd pos) of codon and 5’ (1st pos) of anticodon do not always follow standard base pairing rules

basically,

if 5’ anticodon is G or U, it can pair with 3’ codon U, or G and vice versa