• organic molecules contain carbon

• the major elements of life are carbon, hydrogen, nitrogen, and oxygen

• and acronym for this is C.H.O.P.N.S

General tips

• like dissolves like

Rubisco

• makes inorganic Co2 into glucose

Carbon

• VERY IMPORTANT TO BIOCHEM

• can form up to four bond b/c of its number of valence electrons.

  • Covalent

    • shares electrons

  • ionic

    • takes away valence electron(s)

    • think of the time Mr Schuyler took Manav’s phone and ran around the room.

!!!STRUCTURE = FUNCTION!!!

Variation in Carbon skeletons

• length

• branching

• sharing 2 valence electrons - double bonds(2 lines ==)

• rings

Hydrocarbons

• Long C-H chain

• non-polar covalent

Isomers

• Compounds with the same formula, but a different structure

  • think of your 2 hands, and how they are reversed, but do the same thing

Hydrolysis(to break water, literally)

• breakdown between monomers

• removes water, then separates into a hydroxl(-OH) and an -H

• digestive enzymes hydrolise food into monomers which then enter the bloodstream.

Dehydration synthesis

• dehydration synthesis and hydrolysis have pretty much opposite names from their processes

• makes larger covalent bonds that produce water

• needs enzymes/catalyst.

Functional groups

• behaves the same way regardless of molecule

• effects the structure, therefore the function

Monomers

• single building blocks

• there are about 50 different monomers or”parts” that make up everything in our bodies, DNA included.

  • this makes us less complicated than cars

Carbohydrates

• sugars are their polymers

• dehydration synthesis - make a bigger molecule by removing water

• classified based on numbers of simple sugars

Monosacharides

• ratio of CH_2O, nutrients for cells(glucose) photosynthesis

• energy in bonds

• isomers

• spatial arrangement - 3 d organization of molecules and organic compounds - CH_2O

• forming in water

Disacharides

• double sugar joined by glucose linkage(dehydration synthesis)

Polysacharides

• 100-1000 monosacharides

• enzyme mediated dehydration synthesis

• used for energy storage and structural support

Macromolecule

• large organic polymer, has four classes

  • carbohydrates

  • lipids

  • proteins

  • nucleic acids

starch

• short term energy

• glucose polymer

• storage in plants: t4 linkage(???)

• granules in plastids( plastids are an organelle in plant cells that help with mitochondria)

  • amylose - simplest form - unbranched

  • amylopectin - branched form

Glycogen

• storage in animals - large and highly branched

• stored in muscle and liver - glucose polymer

Cellulose(structural)

• linear chain of glucose units(Picture a straight, sugar necklace, the beads are glucose)

• D-Glucose(in Humans)(just glucose needed to survive, standard glucose)

Chitin(structural)

• polymer of amino sugar

• exoskeleton in arthropods

Lipids

• Think of oil

• insoluble in water, but dissolves in non-polar solvents

• fats, phospholipids(think the cell membranes Phospholipid bi-layer), and steroids

• estrogen and testosterone are lipid based steroids.

Fats

• 2 parts - Glycerol(alcohol—> polar) and fatty acid

• Glycerol - three carbon alcohol

• fatty acid - carboxylic(fatty acid —>non polar)

  • 16-18 carbons

  • non polar

  • enzyme linked dehydration synthesis

  • forms ester link(chemical bonds that join two parts of a molecule together)

  • do you see how the polar and the non polar come together????

  • Animal fats have no double bonds

  • vegetable fats can have double bonds, but they are loose(flexible connection)

Proteins

• made of amino acids

• four levels of protein structure

  • 1) unique amino acid sequence

  • 2)alpha helixes(twisty spiral staircase)(one strand)

  • 3)hydrophobic interactions and disulfide bonds(defined somewhere here)

  • 4)overall shape

• central Dogma(DNA—> RNA—> Amino Acid—>Protein)

• all enzymes are proteins, but not all proteins are enzymes(use da squares analogy)

Nucleic Acids

• stores genetic material

  • genes

  • blueprint for building proteins

  • DNA—> RNA—>proteins

• transfers information

  • blueprint for new cells and next gen

• RNA is single helix

• DNA is double helix

• structure - monomers=nucleotide

• Nucleic acids was the evidence darwin(or Lamark?) was missing!

• Always remember the five prime three prime, if there are arrows pointing opposite directions, you can guess that.

Nucleotide

• 3 parts

  • nitrogen base(C-N ring)

  • pentose sugar(5 C)

    • ribose in RNA

    • Deoxyribose in DNA

  • phosphate(PO_4) group

Types of nucleotide

• 2 types

  • different nitrogen bases

• purines

  • double ring N base

  • adenine

  • Guanine

  • “pure AG(silver)”

• Pyrimidines

  • single ring N base

  • cytosine

  • thymine

  • uracil

Nucleic polymer

• backbone

  • sugar to PO_4 bond

• Phosphodiester bond(

  • new base added to sugar of previous base

  • polymer grows in one direction

• N bases hang off the sugar-phosphate backbone

  • dangling bases are

Pairing Of Nucleotides

• Nucleotides bond between DNA strands

• H- bonds

  • purine::pyrimidine

• A :: T

  • 2 H bonds

• G :: C

  • 3 H bonds

• DNA is a double helix

• H bonds between bases and join the 2 strands

  • A :: T

  • C :: G

Copying DNA

• replication

  • 2 strands of DNA helix are complimentary

    • if it has one, it can build the other

    • if it has one, it can rebuild the whole

When does a cell copy DNA?

• cell reproduction(mitosis)

• gamete production(meiosis)

The History of DNA

• Watson and Crick

  • “discovered” the structure of DNA, but used other peoples research such as . . .

• Maurice Wilkins

  • discovered that A and T, G and C have the corresponding numbers

  • Watson and Crick assumed that meant they went together.

• Rosalind Franklin

  • Saw the top of a DNA Helix

  • corrected Watson and crick on the order of the nucleic acid b/c they had it that the phosphate went on the inside, and that would explode.

  • moved back to France because she was sick of men

Information polymer

• series of based encodes info like letters of a book(ttagcgtaccggcatccgat for example)

• stored info is passed from parent to offspring(this needs to be copied accurately!!)

Gel electrophoresis

• method used to separate particles by size

• bigger molecules=less movement

• DNA is negatively charged, so the wells start on the negative side and(run to red) and move towards the positive side(like how a magnet repels the same charge)

Hydroxl

• _OH

  • alcohols(ethanol is an example)

  • polar

  • water soluble

Carboxyl

• the top is non ionized

• the bottom is ionized

• this functional group is acidic because it donates H- into the solution

• polar

• water soluble

• a combo of a hydroxl and carbonyl

Amino group

• the top is non ionized

• the bottom is ionized

• called amines

• this group is a weak base because it gains a H+ ion, removing them from the solution(so the carboxyl is putting negative ions and Amino group is taking positive ions out of the solution)

• non polar

• generally water soluble

Sulfhydryl

• called a thiol

• helps stabilize protein structure(structure related to function!!) through disulfide bridges(2 sulfer atoms from different parts of the molecule bond very tightly)

• polar

• not very water soluble

phosphate

• called organic phosphates

• acidic, looses h+ ions

• polar

• water soluble

• unstable, so great for energy transfer and storage

carbonyl

• The top is an aldehyde, which means it is on the end of a molecule

• the bottom is a ketone, which means it is in the middle of a molecule.

• polar

• water soluble

• found in all sugars

-