BIO100 LAB

Lab Safety

Emergency Equipment

• Eyewash Station: Rinse eyes for a minimum of 20 minutes

• First-Aid Kit: Inform teacher and contact school nurse

• Fire Extinguisher: Use if teacher is not present

Proper Lab Attire

• Closed-toe shoes

• Lab Apron

• Lab Goggles

• Long hair pulled back

• No dangling jewelry

• No loose/baggy clothing

• Gloves (when dealing with hazardous chemicals)

Fire Drill Procedure

• Put everything back on the table

• Remove lab gloves, goggles, and apron

• Exit through the back door of the classroom

Lab Safety Rules

• No horseplay in the lab

• Do not eat/drink during a lab

• Report any injuries to the teacher

• Clean up after yourself

• Push your chair in when leaving lab

• Do not pick up broken glass with bare hands

• No ingesting or smelling chemicals

Scientific Terms

Definitions

• Independent variable: Variable that the scientist changes

• Dependent variable: Variable that changes as a result of the independent variable

• Hypothesis: Suggested explanation for an observed event

• Constants (Controlled Variables): Variables that are held constant throughout the experiment

• Control Group: Experimental group under 'typical' or 'normal' conditions

• Homeostasis: Condition in which an organism's internal environment is kept stable

• Adaptation: Inherited behavior or physical characteristic that helps an organism survive and reproduce

• Cell: Basic unit of structure and function in living things

• Autotroph: Organism that can capture energy from sunlight or chemicals to produce its own food

• Heterotroph: Organism that cannot make its own food and gets food by consuming other living things

Experiment Scenario

• Hypothesis: Lettuce seeds will not germinate unless they are covered with soil

• Purpose: To determine if lettuce seeds will germinate above the soil

• Independent variable: Where the seeds begin to germinate (above or below the soil)

• Dependent variable: Number of seeds that germinate

• Control Group: Seeds planted under the soil

• Constants: Type of seed, type of soil, amount of water, temperature, number of seeds in each group

Characteristics of Living Organisms

Functions

• Growth

• Reproduction

• Adaptation

• Homeostasis

• Metabolism

• Movement

Requirements for Survival

• Gas exchange

• Water

• Energy/Food

• Elimination of waste

• Suitable environment

Examples of Adaptations

• Cacti storing water in their stems

• Gradual adaptation to heat in a warmer environment

• Giraffes evolving long necks to reach leaves high up in trees

Classification of Organisms

Taxonomy Categories

• Domain

• Kingdom

• Phylum

• Class

• Order

• Family

• Genus

• Species

Domains of Life

• Archaea

• Bacteria

• Eukaryotes

Kingdoms of Life

• Eubacteria

• Archaebacteria

• Fungi

• Plantae

• Animalia

Difference between Autotroph and Heterotroph

• Autotroph: Makes its own food

• Heterotroph: Must consume other living things for food/energy

Difference between Prokaryotes and Eukaryotes

• Prokaryotes: Lack a nucleus and membrane-bound organelles

• Eukaryotes: Have a nucleus and membrane-bound organelles

Characteristics of Protista

• Eukaryotes

• Mostly unicellular, some multicellular

• Can be autotrophs or heterotrophs

• Cell walls made of cellulose

Characteristics of Fungi

• Eukaryotes

• Mostly multicellular, some unicellular

• Heterotrophs

• Cell walls made of chitin

Characteristics of Archaea

• Microscopic

• Unicellular

• Lack a nucleus and organelles

• Different cell walls and membranes from bacteria and eukaryotes

Characteristics of Bacteria

• Microscopic

• Unicellular

• Lack a nucleus and organelles

Cell Structure and Function

Definitions

• Ribosome: Organelle that produces proteins

• Chloroplast: Organelle that captures energy from sunlight for food production

• Nucleus: Organelle that contains genetic material and controls cell activities

• Cytoplasm: Thick fluid region inside the cell membrane

• Golgi Apparatus: Organelle that receives and distributes proteins

• Mitochondria: Organelles that convert energy in food to usable energy

• Diffusion: Process of molecules moving from higher to lower concentration

• Osmosis: Diffusion of water across a selectively permeable membrane

Microscope Usage

• Hold the microscope with one hand on the arm and one hand under the base

• Clean the lenses with lens paper

• Components: Diaphragm, Course adjustment knob, Stage, Light source, Rotating nosepiece

Animal and Plant Cell Organelles

• Animal Cell: Cytoplasm, Mitochondria, Nucleus, Golgi Apparatus, Endoplasmic Reticulum

• Plant Cell: Cytoplasm, Mitochondria, Nucleus, Golgi Apparatus, Endoplasmic Reticulum, Chloroplast

Preparing a Wet Mount Slide

• Clean the microscope slide with lens paper

• Place a drop of water or saline solution in the middle of the slide

• For plant cells, use tweezers to place the specimen in the water

• For animal cells, swab the sample and swirl it in the saline solution

• Place the cover slip on at an angle to prevent air bubbles

Cell Theory

• Every living thing is made of one or more cells

• Cells carry out functions needed to support life

• Cells come only from other living cells

Important Scientists

• Anton van Leeuwenhoek: Father of microbiology

• Robert Hooke: First scientist to view cells

• Louis Pasteur: Developed germ theory

Active and Passive Transport

• Active transport: Requires energy to move across the cell membrane

• Passive transport: Does not require energy to move across the cell membrane

Importance of Nucleic Acids

• Nucleic acids are DNA, which holds instructions for maintenance, growth, and reproduction

Large Molecules

• Proteins: Chains of amino acids

• Carbohydrates: Main molecules for providing energy

• Lipids: Fats, oils, and waxes found in living things

Endocytosis and Exocytosis

• Endocytosis: Materials entering the cell

• Exocytosis: Cell getting rid of materials

Equations for Photosynthesis and Cellular Respiration

• Photosynthesis: 6CO2 + 6H2O -> C6H12O6 + 6O2

• Cellular Respiration: C6H12O6 + 6O2 -> 6CO2 + 6H2O + ATP

Diffusion and Concentration

• Molecules always move from higher to lower concentration in diffusion

DNA and Cell Division

DNA and RNA

• DNA: Deoxyribose Nucleic Acid

• RNA: Ribonucleic Acid

• DNA Bases: Adenine (pairs with thymine), Cytosine (pairs with guanine), Thymine (pairs with adenine), Guanine (pairs with cytosine)

DNA Structure and Replication

• DNA Structure: Double Helix

• Nucleotide Components: Deoxyribose sugar, phosphate group, organic base

• Complementary DNA Strands: CGTAGCGCTATAGCATCGCGATAT, TACTATCGATCGATAGAATGCTAG

Mitosis

• Steps: Prophase, Metaphase, Anaphase, Telophase

• Interphase: Growth, normal cell functions, replication of organelles and DNA

Meiosis

• Similarities with Mitosis: Follows PMAT, has interphase, results in new cells

• Differences with Mitosis: Goes through PMAT twice, produces 4 cells, purpose is reproduction, creates genetic variation

Cell Division Photos

• Telophase II and Cytokinesis

• Metaphase II

• Prophase I

Enzymes

• Enzymes are proteins that speed up chemical reactions in the body

• Lab Safety:

  1. Which of the following should always be worn in the laboratory to protect your eyes?
     a) Safety goggles
     b) Glasses
     c) Contact lenses
     d) Sunglasses

  2. What should you do before starting any experiment in the lab?
     a) Read the procedure carefully
     b) Only ask for help if something goes wrong
     c) Begin without preparing
     d) Assume you know all the steps

  3. What is the purpose of a lab coat?
     a) To keep you warm
     b) To protect your clothes from spills
     c) To identify your role in the lab
     d) To make you look professional

  4. What is the first thing you should do if you spill a chemical on your skin?
     a) Run away from the spill
     b) Rinse with water immediately
     c) Wait for the instructor to assist
     d) Ignore it if it's a minor spill

  ---

  Experimental Design:

  5. What is the purpose of a control group in an experiment?
     a) To test the variable
     b) To provide a baseline for comparison
     c) To eliminate bias
     d) To increase the sample size

  6. Which of the following is true about a hypothesis?
     a) It must always be correct
     b) It must be testable and falsifiable
     c) It cannot be based on observations
     d) It must be a final conclusion

  7. In a scientific experiment, what is the independent variable?
     a) The factor that changes in response to other variables
     b) The factor that is kept constant throughout the experiment
     c) The factor that the experimenter manipulates
     d) The factor that is measured

  8. Which of the following is a key characteristic of a good experiment?
     a) It is done in a single trial
     b) It is based on observations
     c) It controls all variables except the one being tested
     d) It avoids using a control group

  ---

  Biological Molecules:

  9. What are enzymes primarily responsible for in cells?
     a) Storing genetic information
     b) Catalyzing chemical reactions
     c) Transporting molecules across the membrane
     d) Creating energy

  10. Which of the following is an example of a carbohydrate?
      a) Glucose
      b) DNA
      c) Amino acids
      d) Fatty acids

  11. What is the primary function of lipids in cells?
      a) Provide energy
      b) Store genetic information
      c) Form membranes
      d) Act as enzymes

  12. Which molecule is the building block of proteins?
      a) Nucleotides
      b) Fatty acids
      c) Amino acids
      d) Monosaccharides

  13. Which of the following is the correct monomer for nucleic acids?
      a) Amino acids
      b) Nucleotides
      c) Fatty acids
      d) Glucose

  ---

  Microscopes and Cells:

  14. Which part of the microscope controls the amount of light passing through the specimen?
      a) Coarse adjustment
      b) Condenser lens
      c) Diaphragm
      d) Eyepiece

  15. What is the main function of the ribosome in a cell?
      a) Store genetic material
      b) Produce energy
      c) Synthesize proteins
      d) Control cell division

  16. Which of the following is unique to eukaryotic cells?
      a) Ribosomes
      b) Mitochondria
      c) Nucleus
      d) Plasma membrane

  17. Which structure in the cell is responsible for storing genetic material?
      a) Mitochondria
      b) Nucleus
      c) Endoplasmic reticulum
      d) Golgi apparatus

  ---

  Cell Membranes and Transport:

  18. Which process requires no energy to move molecules across the cell membrane?
      a) Active transport
      b) Diffusion
      c) Endocytosis
      d) Exocytosis

  19. Which of the following types of molecules can pass through the cell membrane most easily?
      a) Large polar molecules
      b) Ions
      c) Small nonpolar molecules
      d) Water molecules

  20. What is the role of transport proteins in the cell membrane?
      a) To act as channels or carriers for molecules
      b) To store energy
      c) To provide structural support
      d) To synthesize proteins

  21. Which of the following best describes osmosis?
      a) Movement of molecules from low to high concentration
      b) Movement of water from high to low concentration
      c) Movement of ions through a pump
      d) Movement of glucose into the cell

  22. What is a characteristic of a hypertonic solution?
      a) The solution has a higher concentration of solutes than the inside of the cell.
      b) The solution has a lower concentration of solutes than the inside of the cell.
      c) The solution has equal solute concentration as the inside of the cell.
      d) The solution is isotonic to the surrounding environment.

  23. The solution causes the cell to lose water and potentially shrink due to osmosis.