BIO100 LAB

Lab Safety

Emergency Equipment

• Eyewash Station: Rinse eyes for a minimum of 20 minutes

• First-Aid Kit: Inform teacher and contact school nurse

• Fire Extinguisher: Use if teacher is not present

Proper Lab Attire

• Closed-toe shoes

• Lab Apron

• Lab Goggles

• Long hair pulled back

• No dangling jewelry

• No loose/baggy clothing

• Gloves (when dealing with hazardous chemicals)

Fire Drill Procedure

• Put everything back on the table

• Remove lab gloves, goggles, and apron

• Exit through the back door of the classroom

Lab Safety Rules

• No horseplay in the lab

• Do not eat/drink during a lab

• Report any injuries to the teacher

• Clean up after yourself

• Push your chair in when leaving lab

• Do not pick up broken glass with bare hands

• No ingesting or smelling chemicals

Scientific Terms

Definitions

• Independent variable: Variable that the scientist changes

• Dependent variable: Variable that changes as a result of the independent variable

• Hypothesis: Suggested explanation for an observed event

• Constants (Controlled Variables): Variables that are held constant throughout the experiment

• Control Group: Experimental group under 'typical' or 'normal' conditions

• Homeostasis: Condition in which an organism's internal environment is kept stable

• Adaptation: Inherited behavior or physical characteristic that helps an organism survive and reproduce

• Cell: Basic unit of structure and function in living things

• Autotroph: Organism that can capture energy from sunlight or chemicals to produce its own food

• Heterotroph: Organism that cannot make its own food and gets food by consuming other living things

Experiment Scenario

• Hypothesis: Lettuce seeds will not germinate unless they are covered with soil

• Purpose: To determine if lettuce seeds will germinate above the soil

• Independent variable: Where the seeds begin to germinate (above or below the soil)

• Dependent variable: Number of seeds that germinate

• Control Group: Seeds planted under the soil

• Constants: Type of seed, type of soil, amount of water, temperature, number of seeds in each group

Characteristics of Living Organisms

Functions

• Growth

• Reproduction

• Adaptation

• Homeostasis

• Metabolism

• Movement

Requirements for Survival

• Gas exchange

• Water

• Energy/Food

• Elimination of waste

• Suitable environment

Examples of Adaptations

• Cacti storing water in their stems

• Gradual adaptation to heat in a warmer environment

• Giraffes evolving long necks to reach leaves high up in trees

Classification of Organisms

Taxonomy Categories

• Domain

• Kingdom

• Phylum

• Class

• Order

• Family

• Genus

• Species

Domains of Life

• Archaea

• Bacteria

• Eukaryotes

Kingdoms of Life

• Eubacteria

• Archaebacteria

• Fungi

• Plantae

• Animalia

Difference between Autotroph and Heterotroph

• Autotroph: Makes its own food

• Heterotroph: Must consume other living things for food/energy

Difference between Prokaryotes and Eukaryotes

• Prokaryotes: Lack a nucleus and membrane-bound organelles

• Eukaryotes: Have a nucleus and membrane-bound organelles

Characteristics of Protista

• Eukaryotes

• Mostly unicellular, some multicellular

• Can be autotrophs or heterotrophs

• Cell walls made of cellulose

Characteristics of Fungi

• Eukaryotes

• Mostly multicellular, some unicellular

• Heterotrophs

• Cell walls made of chitin

Characteristics of Archaea

• Microscopic

• Unicellular

• Lack a nucleus and organelles

• Different cell walls and membranes from bacteria and eukaryotes

Characteristics of Bacteria

• Microscopic

• Unicellular

• Lack a nucleus and organelles

Cell Structure and Function

Definitions

• Ribosome: Organelle that produces proteins

• Chloroplast: Organelle that captures energy from sunlight for food production

• Nucleus: Organelle that contains genetic material and controls cell activities

• Cytoplasm: Thick fluid region inside the cell membrane

• Golgi Apparatus: Organelle that receives and distributes proteins

• Mitochondria: Organelles that convert energy in food to usable energy

• Diffusion: Process of molecules moving from higher to lower concentration

• Osmosis: Diffusion of water across a selectively permeable membrane

Microscope Usage

• Hold the microscope with one hand on the arm and one hand under the base

• Clean the lenses with lens paper

• Components: Diaphragm, Course adjustment knob, Stage, Light source, Rotating nosepiece

Animal and Plant Cell Organelles

• Animal Cell: Cytoplasm, Mitochondria, Nucleus, Golgi Apparatus, Endoplasmic Reticulum

• Plant Cell: Cytoplasm, Mitochondria, Nucleus, Golgi Apparatus, Endoplasmic Reticulum, Chloroplast

Preparing a Wet Mount Slide

• Clean the microscope slide with lens paper

• Place a drop of water or saline solution in the middle of the slide

• For plant cells, use tweezers to place the specimen in the water

• For animal cells, swab the sample and swirl it in the saline solution

• Place the cover slip on at an angle to prevent air bubbles

Cell Theory

• Every living thing is made of one or more cells

• Cells carry out functions needed to support life

• Cells come only from other living cells

Important Scientists

• Anton van Leeuwenhoek: Father of microbiology

• Robert Hooke: First scientist to view cells

• Louis Pasteur: Developed germ theory

Active and Passive Transport

• Active transport: Requires energy to move across the cell membrane

• Passive transport: Does not require energy to move across the cell membrane

Importance of Nucleic Acids

• Nucleic acids are DNA, which holds instructions for maintenance, growth, and reproduction

Large Molecules

• Proteins: Chains of amino acids

• Carbohydrates: Main molecules for providing energy

• Lipids: Fats, oils, and waxes found in living things

Endocytosis and Exocytosis

• Endocytosis: Materials entering the cell

• Exocytosis: Cell getting rid of materials

Equations for Photosynthesis and Cellular Respiration

• Photosynthesis: 6CO2 + 6H2O -> C6H12O6 + 6O2

• Cellular Respiration: C6H12O6 + 6O2 -> 6CO2 + 6H2O + ATP

Diffusion and Concentration

• Molecules always move from higher to lower concentration in diffusion

DNA and Cell Division

DNA and RNA

• DNA: Deoxyribose Nucleic Acid

• RNA: Ribonucleic Acid

• DNA Bases: Adenine (pairs with thymine), Cytosine (pairs with guanine), Thymine (pairs with adenine), Guanine (pairs with cytosine)

DNA Structure and Replication

• DNA Structure: Double Helix

• Nucleotide Components: Deoxyribose sugar, phosphate group, organic base

• Complementary DNA Strands: CGTAGCGCTATAGCATCGCGATAT, TACTATCGATCGATAGAATGCTAG

Mitosis

• Steps: Prophase, Metaphase, Anaphase, Telophase

• Interphase: Growth, normal cell functions, replication of organelles and DNA

Meiosis

• Similarities with Mitosis: Follows PMAT, has interphase, results in new cells

• Differences with Mitosis: Goes through PMAT twice, produces 4 cells, purpose is reproduction, creates genetic variation

Cell Division Photos

• Telophase II and Cytokinesis

• Metaphase II

• Prophase I

Enzymes

• Enzymes are proteins that speed up chemical reactions in the body