EB

BIO100 LAB

Lab Safety

Emergency Equipment

  • Eyewash Station: Rinse eyes for a minimum of 20 minutes

  • First-Aid Kit: Inform teacher and contact school nurse

  • Fire Extinguisher: Use if teacher is not present

Proper Lab Attire

  • Closed-toe shoes

  • Lab Apron

  • Lab Goggles

  • Long hair pulled back

  • No dangling jewelry

  • No loose/baggy clothing

  • Gloves (when dealing with hazardous chemicals)

Fire Drill Procedure

  • Put everything back on the table

  • Remove lab gloves, goggles, and apron

  • Exit through the back door of the classroom

Lab Safety Rules

  • No horseplay in the lab

  • Do not eat/drink during a lab

  • Report any injuries to the teacher

  • Clean up after yourself

  • Push your chair in when leaving lab

  • Do not pick up broken glass with bare hands

  • No ingesting or smelling chemicals

Scientific Terms

Definitions

  • Independent variable: Variable that the scientist changes

  • Dependent variable: Variable that changes as a result of the independent variable

  • Hypothesis: Suggested explanation for an observed event

  • Constants (Controlled Variables): Variables that are held constant throughout the experiment

  • Control Group: Experimental group under 'typical' or 'normal' conditions

  • Homeostasis: Condition in which an organism's internal environment is kept stable

  • Adaptation: Inherited behavior or physical characteristic that helps an organism survive and reproduce

  • Cell: Basic unit of structure and function in living things

  • Autotroph: Organism that can capture energy from sunlight or chemicals to produce its own food

  • Heterotroph: Organism that cannot make its own food and gets food by consuming other living things

Experiment Scenario

  • Hypothesis: Lettuce seeds will not germinate unless they are covered with soil

  • Purpose: To determine if lettuce seeds will germinate above the soil

  • Independent variable: Where the seeds begin to germinate (above or below the soil)

  • Dependent variable: Number of seeds that germinate

  • Control Group: Seeds planted under the soil

  • Constants: Type of seed, type of soil, amount of water, temperature, number of seeds in each group

Characteristics of Living Organisms

Functions

  • Growth

  • Reproduction

  • Adaptation

  • Homeostasis

  • Metabolism

  • Movement

Requirements for Survival

  • Gas exchange

  • Water

  • Energy/Food

  • Elimination of waste

  • Suitable environment

Examples of Adaptations

  • Cacti storing water in their stems

  • Gradual adaptation to heat in a warmer environment

  • Giraffes evolving long necks to reach leaves high up in trees

Classification of Organisms

Taxonomy Categories

  • Domain

  • Kingdom

  • Phylum

  • Class

  • Order

  • Family

  • Genus

  • Species

Domains of Life

  • Archaea

  • Bacteria

  • Eukaryotes

Kingdoms of Life

  • Eubacteria

  • Archaebacteria

  • Fungi

  • Plantae

  • Animalia

Difference between Autotroph and Heterotroph

  • Autotroph: Makes its own food

  • Heterotroph: Must consume other living things for food/energy

Difference between Prokaryotes and Eukaryotes

  • Prokaryotes: Lack a nucleus and membrane-bound organelles

  • Eukaryotes: Have a nucleus and membrane-bound organelles

Characteristics of Protista

  • Eukaryotes

  • Mostly unicellular, some multicellular

  • Can be autotrophs or heterotrophs

  • Cell walls made of cellulose

Characteristics of Fungi

  • Eukaryotes

  • Mostly multicellular, some unicellular

  • Heterotrophs

  • Cell walls made of chitin

Characteristics of Archaea

  • Microscopic

  • Unicellular

  • Lack a nucleus and organelles

  • Different cell walls and membranes from bacteria and eukaryotes

Characteristics of Bacteria

  • Microscopic

  • Unicellular

  • Lack a nucleus and organelles

Cell Structure and Function

Definitions

  • Ribosome: Organelle that produces proteins

  • Chloroplast: Organelle that captures energy from sunlight for food production

  • Nucleus: Organelle that contains genetic material and controls cell activities

  • Cytoplasm: Thick fluid region inside the cell membrane

  • Golgi Apparatus: Organelle that receives and distributes proteins

  • Mitochondria: Organelles that convert energy in food to usable energy

  • Diffusion: Process of molecules moving from higher to lower concentration

  • Osmosis: Diffusion of water across a selectively permeable membrane

Microscope Usage

  • Hold the microscope with one hand on the arm and one hand under the base

  • Clean the lenses with lens paper

  • Components: Diaphragm, Course adjustment knob, Stage, Light source, Rotating nosepiece

Animal and Plant Cell Organelles

  • Animal Cell: Cytoplasm, Mitochondria, Nucleus, Golgi Apparatus, Endoplasmic Reticulum

  • Plant Cell: Cytoplasm, Mitochondria, Nucleus, Golgi Apparatus, Endoplasmic Reticulum, Chloroplast

Preparing a Wet Mount Slide

  • Clean the microscope slide with lens paper

  • Place a drop of water or saline solution in the middle of the slide

  • For plant cells, use tweezers to place the specimen in the water

  • For animal cells, swab the sample and swirl it in the saline solution

  • Place the cover slip on at an angle to prevent air bubbles

Cell Theory

  • Every living thing is made of one or more cells

  • Cells carry out functions needed to support life

  • Cells come only from other living cells

Important Scientists

  • Anton van Leeuwenhoek: Father of microbiology

  • Robert Hooke: First scientist to view cells

  • Louis Pasteur: Developed germ theory

Active and Passive Transport

  • Active transport: Requires energy to move across the cell membrane

  • Passive transport: Does not require energy to move across the cell membrane

Importance of Nucleic Acids

  • Nucleic acids are DNA, which holds instructions for maintenance, growth, and reproduction

Large Molecules

  • Proteins: Chains of amino acids

  • Carbohydrates: Main molecules for providing energy

  • Lipids: Fats, oils, and waxes found in living things

Endocytosis and Exocytosis

  • Endocytosis: Materials entering the cell

  • Exocytosis: Cell getting rid of materials

Equations for Photosynthesis and Cellular Respiration

  • Photosynthesis: 6CO2 + 6H2O -> C6H12O6 + 6O2

  • Cellular Respiration: C6H12O6 + 6O2 -> 6CO2 + 6H2O + ATP

Diffusion and Concentration

  • Molecules always move from higher to lower concentration in diffusion

DNA and Cell Division

DNA and RNA

  • DNA: Deoxyribose Nucleic Acid

  • RNA: Ribonucleic Acid

  • DNA Bases: Adenine (pairs with thymine), Cytosine (pairs with guanine), Thymine (pairs with adenine), Guanine (pairs with cytosine)

DNA Structure and Replication

  • DNA Structure: Double Helix

  • Nucleotide Components: Deoxyribose sugar, phosphate group, organic base

  • Complementary DNA Strands: CGTAGCGCTATAGCATCGCGATAT, TACTATCGATCGATAGAATGCTAG

Mitosis

  • Steps: Prophase, Metaphase, Anaphase, Telophase

  • Interphase: Growth, normal cell functions, replication of organelles and DNA

Meiosis

  • Similarities with Mitosis: Follows PMAT, has interphase, results in new cells

  • Differences with Mitosis: Goes through PMAT twice, produces 4 cells, purpose is reproduction, creates genetic variation

Cell Division Photos

  • Telophase II and Cytokinesis

  • Metaphase II

  • Prophase I

Enzymes

  • Enzymes are proteins that speed up chemical reactions in the body