BIOL 3080 LEcutre 4 - PCR

PCR: Polymerase Chain Reaction

• Definition: PCR (Polymerase Chain Reaction) is a rapid, efficient technique for generating copies of any DNA fragment.

• Revolution: It revolutionized molecular biology after being described in 1986.

• Applications:

  • Medical diagnosis

  • Forensic investigation

  • Allows for the analysis of tiny amounts of genetic material.

Importance of PCR

• Gene Cloning and DNA Sequencing: Requires significant amounts of high-quality, intact DNA.

• Applications in Forensics: Often involves limited amounts of sample material, where DNA may not suffice for analyses.

Components of PCR

1. Template DNA

2. DNA Polymerase

3. Four deoxynucleoside triphosphates (dNTPs): Adenine (A), Thymine (T), Guanine (G), Cytosine (C)

4. Two Primers

PCR Process Overview

Steps of PCR:

1. Denaturation:

   • The double-stranded DNA template is heated, causing the DNA strands to separate into individual strands.

2. Annealing:

   • The solution is cooled; primers anneal to their complementary sequences on the template strands.

3. Extension:

   • DNA polymerase synthesizes new DNA strands that are complementary to the template DNA, extending primers in a 5’ to 3’ direction.

Cycle Description

• Amplification Cycles: The template duplex is usually longer than the amplified region.

• Length of Primers: Typically 20–30 nucleotides in length, designed for amplification.

• Pairing Orientation: Primers have their 3' ends oriented toward each other and added in excess to ensure binding to complementary sequences.

Amplification Results

• After $n$ cycles of amplification, the number of copies of the template sequence is $2^n$.

• Example: When $n = 30$, the copies are $2^{30} ext{ or approximately } 1 imes 10^9$.

Calculation of Copies After Cycles

• After 3 cycles, the number of DNA copies is calculated as:

  • Total DNA $= 2 imes (2^3)$.

  • Each cycle doubles the number of DNA strands.

PCR Primer Characteristics

• Melting Temperature (Tm): The melting temperature of the two primers should be within 5ºC of each other.

  • Tm formula:
    Tm = [4(G ext{ or } C) + 2(T ext{ or } A)] - 5ºC.

  • Example Calculation:

    • For the primer sequence $5' ext{GCGGAAGAAGTAACAAAGGA} 3'$, Tm:
      Tm = [4(9) + 2(11)] - 5ºC = 53ºC.

• Orientation of Primers:

  • Written as 5’-3’.

  • Critical for synthesis: 3' end match is essential; 5' can have extra bases (e.g., restriction enzyme sites can be added).

Primer Design Examples

• Example sequences for primers:

  • GCATGATAAGCAAATTATAACTAGAACTAGCAAAAGCGATGCG

  • GCGGGATGAACAAATCCTTTCTAGGGCTAGCATTAGCGATGCG

  • GCCCGATGGGCAAATTATTTCTAGGGCTAGCATTTGAGATGCG

  • TAAGCAAATTATAACTAGAA

  • GCCCTAGAAATAATTTGCCC

Factors Contributing to PCR Popularity

1. Availability of Heat-Resistant DNA Polymerases: Essential for high temperatures.

2. Automation of Temperature Control: Utilized in heat blocks for PCR efficiency.

3. Decrease in Costs: Significant reduction in prices of thermocyclers and heat-tolerant DNA polymerases.

Comparison: Automated vs Manual PCR

• Manual Procedures in Early PCR:

  • Used multiple heat blocks at different temperatures.

  • Required manual transfer of the reaction tube for each phase of the process.

  • E. coli polymerase deactivated at high temperatures, necessitating fresh additions.

• Temperature Timing:

  • 95°C for 5 minutes

  • 25-40 cycles of 95°C for 0.5-2 minutes, 50-72°C for 0.5-2 minutes, and 72°C for 1 minute per kb.

  • 72°C for 5-30 minutes, 4°C indefinitely.

Taq Polymerase

• Source: Taq is derived from the bacterium Thermus aquaticus found in hot springs.

• Function: Remains active throughout multiple PCR amplification cycles, facilitating automation.

Thermocyclers

• Description: PCR reactions are carried out in a thermocycler, an electronically controlled heat block that can automatically shift temperatures for each PCR cycle.

• Advantage: Eliminates the need for monitoring, allowing unattended reactions over hours.

Gel Electrophoresis

• Principle: DNA fragments migrate towards the positive pole based on size—smaller fragments travel faster while larger ones move slowly.

• Procedure: Samples inserted into wells on an agarose gel.

• Visualization: Bands become visible under fluorescent lights, with each band corresponding to DNA of a particular size.

Gel Electrophoresis Details

• Key Phrase: "Run to Red"—indicating that DNA runs toward the positive electrode.

• Gel Composition: Agarose gel with microscopic pores.

• Size and Migration: Larger molecules migrate more slowly.

Size Correlation

• Travel Distance: The distance moved in the gel relates to the size of the DNA fragment.

• Use of Ethidium Bromide (EtBr): An intercalating agent that inserts between DNA bases, enabling band visualization.

• Molecular Differentiation: Separation of sizes and recovery for future use is possible.

RT-PCR (Reverse Transcription PCR)

• Definition: Reverse transcription polymerase chain reaction enables the synthesis of DNA from RNA templates.

• Procedure:

  • Isolate total RNA from samples, remove genomic DNA (gDNA), and employ reverse transcriptase to create complementary DNA (cDNA) from an RNA template.

qPCR (Quantitative PCR)

• Definition: Measure the DNA amplification in real time during the PCR process.

• Importance: The original DNA concentration determines the rate of product generation.

• Application: Gene expression studies monitor fluorescence to quantify starting concentration of mRNA.

Applications in Diagnostics and Forensics

• PCR in Diagnostics: Used to detect rare pathogens like HIV, involving steps such as extracting RNA, cDNA PCR amplification, and gel electrophoresis.

• Forensic Applications: Involves analyzing DNA at specific loci and separating products via gel electrophoresis.

DNA Profiling in Forensics

• Concept: DNA contains stretches of short identical repeat sequences whose lengths vary in individuals, aiding in profiling.

• Analysis: Increasing observed loci increases variability, thereby reducing the likelihood of coinciding combinations across individuals.

• Example: Repeats like "ACACACACACAC" may repeat 11 times, with extensive variability based on locus examined.

Genetic Transformation

• Definition: Involves the insertion of a gene into an organism.

• Applications:

  • Agriculture: Genes for frost and pest resistance in plants.

  • Bioremediation: Bacteria can be transformed to digest oil spills.

  • Medicine: Gene therapy for diseases from defective genes.

• Utility of Vectors: Utilizes plasmids modified for these purposes.

Plasmids Overview

• Characteristics: Plasmids are small, circular, double-stranded, extrachromosomal DNA elements in bacteria, ranging from 1 kb to >200 kb in size.

• Copy Number: Varies from 1 to >1000 plasmids per bacterial cell.

Plasmid Topology

• Visual Representation: Typically depicted as a double circle to symbolize 2 DNA strands.

• Supercoiling: Plasmids exist under super-helical tension with various forms:

  • Negative Supercoiling

  • Linear Form

  • Nicked Circular Form

  • Concatamers

• Migration Rates: Different topological forms migrate at varied rates in agarose gels despite having the same molecular weight.

Genes Encoded on Plasmids

• Essential Genes: Required for plasmid replication and propagation.

  • Origin of Replication (ori): Essential for plasmid copying.

  • Partitioning Genes: Ensure proper segregation into daughter cells during division.

• Advantageous Genes: Often include genes for antibiotic resistance, such as the Ampicillin resistance gene (AmpR), which creates b-lactamase to inactivate ampicillin.

Development of Plasmid Cloning Vectors

• Key Components:

  • Selectable Marker: An antibiotic resistance gene allows growth in the presence of an antibiotic; only bacteria with the plasmid survive.

  • Multiple Cloning Site (MCS): A region with various restriction enzyme sites for easy insertion/removal of DNA fragments.

  • Regulatory Signals: Include promoter sequences facilitating the expression of inserted genes.

pGLO Plasmid

• Contents: Contains the Green Fluorescent Protein (GFP) gene from the jellyfish Aequorea victoria, along with a promoter that is induced by arabinose, and a gene for ampicillin resistance.

DNA Cloning Process

• Steps:

  1. Isolate the DNA fragment containing the gene of interest.

  2. Insert the fragment into a plasmid to create a recombinant DNA molecule.

  3. Introduce this recombinant plasmid into a host cell (typically E. coli).

  4. Plate transformed bacteria under selective conditions, so only cells with the plasmid form colonies.

Transformation of Bacteria

• Process:

  • Transformation can involve free DNA uptake through various methods, leading to the successful introduction of plasmids into bacterial cells.

Methods of Introducing DNA

Techniques for Transformation:

1. Calcium Chloride Treatment and Heat-Shock:

   • Simple but low efficiency (10^5 to 10^7 colonies/mg of DNA).

   • Method: Incubate bacterial cells with cold CaCl₂ solution, add DNA, apply heat-shock, allow recovery.

2. Electroporation:

   • High transformation efficiency (10^8 to 10^9 colonies/mg of DNA).

   • Method: Use short electrical pulses to create temporary pores in the cell membrane allowing DNA entry.

   • Wash cells to remove residual ions, add DNA, and electroporate.

3. Lipofection:

   • Complex with DNA in artificial liposome to facilitate membrane fusion.

   • It is an expensive technique primarily used for non-bacterial cells.

4. Microinjection and Gene Guns: Generally, not used for bacterial transformation.

Conclusion

• Significance: Understanding PCR, its components, processes, and applications are crucial for molecular biology, genetic engineering, diagnostics, and forensic science.