1

AP Biology

Unit 7

Student Notes

2

Unit 7 Student Notes

Table of Contents

A. History of the Theory of Evolution—Pages 3-8

B. Evolution Via Natural Selection—Pages 6-8

C. Patterns of Selection—Pages 8-9

D. Population Genetics—Pages 9-11

E. Hardy Weinberg Equilibrium—Pages 10-11

F. Hardy Weinberg Equations—Pages 10-11

G. Genetic Drift—Page 11-12

H. Patterns of Evolution—Page 12

I. Speciation—Pages 12-13

J. Types of Speciation—Pages 12-14

K. Adaptive Radiation—Pages 14-15

L. Reproductive Isolating Mechanisms—Page 15

M. Evidence for Evolution—Pages 16-17

N. Types of Evolution—Page 18

O. Phylogenetic Relationships/Shared Ancestry—Pages 18-24

P. Methods Used to Depict Phylogenetic Relationships—Pages 21-24

Q. Constructing a Cladogram Based on Morphology—Pages 21-23

R. Using Molecular Evidence to Create Cladograms—Pages 23-24

S. Origins of Life on Earth—Pages 24-25

T. Extinction—Pages 25-26

U. Variations in Populations—Pages 26-27

3

Unit 7

Evolution

Student Notes

Important Ideas/Enduring Understandings for this unit.

A. Evolution is characterized by a change in the genetic makeup of a population over time and is

supported by multiple lines of evidence.

B. Organisms are linked by lines of descent from common ancestry.

C. Life continues to evolve within a changing environment.

D. Naturally occurring diversity among and between components within biological systems affects

interactions with the environment.

History of The Theory of Evolution

Carolus Linnaeus (1707 – 1778)

He is considered the Father of Taxonomy. (Taxonomy is the Science of species classification.) There

were originally only two Kingdoms in his system: Plantae & Animalia.

His system uses Binomial Nomenclature. This means that he assigned a two-part name to each

organism.

Rules of Binomial Nomenclature:

The Genus name is written first and has a capitalized first letter.

The Species name is written second and is not capitalized.

The whole name is written in Latin and italicized or underlined.

The current levels (called “taxa”) of classification include:

Domain (This is the MOST inclusive; yet LEAST specific taxon.)

Domains are composed of similar, evolutionarily-related Kingdoms.

Kingdoms

Kingdoms are composed from similar, evolutionarily-related Phyla or Divisions (if it is plants).

4

A Phylum or Division (used with plants) is composed of similar, evolutionarily-related Classes.

Classes are composed of similar, evolutionarily-related Orders.

Orders are composed of similar, evolutionarily-related Families.

Families are composed of similar, evolutionarily-related Genus.

A Genus is composed of similar, evolutionarily-related Species. The plural of genus is genera.

Species (This is the LEAST inclusive; yet MOST specific taxon)

A breed is a sub category of a species.

An easy way to remember the order of the taxa in the system is the following acronym: Dominating King

Phillip Came Over For Green Salad.

Although Linnaeus originally based his taxonomic system on morphology (body shape/structure), the

modern classification system is based on evolutionary relationships. Organisms in the same taxa are

classified there because they share common ancestors.

5

Classification of Modern Humans

Charles Lyell (1797 – 1875)

He became Darwin’s best friend over several years of reviewing and supporting Darwin’s research.

He was a Geologist who wrote Principles of Geology. (Darwin took this book on the Beagle voyage.)

The book was an important influence on Darwin’s thought process and his eventual theories.

In the book, Lyell proposed the Theory of Uniformitarianism. (“The key to the past is the

present”.) The theory tries to explain that the same geologic processes that are occurring

today, also occurred in the past. These processes helped to create, over millions of years,

the geologic formations we see today. For example, erosion, over millions of years and

STILL today, led to the formation of the Grand Canyon. For this theory to work, Earth

must be hundreds of millions of years old. (This also supports Darwin’s theory… it

provides enough time to pass so that we get the millions of different species to evolve.)

6

Jean Baptiste Lamarck (1744 – 1829)

Lamarck proposed a theory of evolution via the inheritance of acquired traits. He proposed this

theory in 1809, the year Charles Darwin was born.

The evolution of the giraffe is often used as an example.

Main tenets

1. Living organisms or their component parts tend to increase in size.

2. Production of a new organ occurs when there is a new need.

3. Continued use of an organ makes it more developed, while disuse of an organ

results in degeneration.

4. Acquired characters (or modifications) developed by individuals during their own

lifetime are inheritable and accumulate over a period of time resulting in a new

species.

Problems with the theory: Was proposed before genetics was understood.

Acquired traits cannot be inherited.

Evolution via Natural Selection

Proposed by Charles Darwin and Alfred Wallace in 1859. This is the current, accepted theory of

evolution.

Compatible with an understanding of genetics.

According to Darwin, natural selection is the mechanism of evolution.

Natural Selection is the process in which the organisms best adapted to their environment tend to survive and

transmit their genetic characters in increasing numbers to succeeding generations while those less adapted tend to be

eliminated.

Natural selection is one of the major mechanisms of evolution.

Evolution is about reproduction. Those organisms that are better adapted to an environment out reproduce those

that are poorly adapted to the environment.

Factors that must be in place for evolution to occur:

1. Genetic Variability—Variation may come from sexual reproduction (random fertilization, crossing over, and

independent assortment), mutations, immigration.

2. More offspring are produced than can survive (due to limited resources, predation, etc…)

3. Some organisms must have phenotypes that are better adapted than others. These phenotypic variations

significantly increase the fitness of the organism in their current environment. These adaptations must have a

genetic basis. Natural selection acts on phenotypic variations within a population.

4. There must be differential reproduction rates due to the adaptive characteristics of some

members.

Essentially, Darwin’s theory says that competition for limited resources results in

differential survival. Individuals with more favorable phenotypes (for that specific

7

environment) are more likely to survive and produce offspring, thus passing traits to

subsequent generations more often than their counterparts with less favorable phenotypes.

The biotic and abiotic factors in an environment can be more or less stable/fluctuating and can

affect the rate and direction of evolution. Different genetic variations can be selected for in each

generation. Essentially, this means that environments can change and thus apply different

selective pressures to populations at different times.

Evolution is often referred to as “survival of the fittest”.

In a biological context, fitness means: the ability to survive to reproductive age, find a mate, and produce

offspring. Basically, the more offspring an organism produces during its lifetime, the greater its biological

fitness. Biological fitness has nothing to do with size or strength. Fitness is measured by reproductive

success.

Fecundity is the actual reproductive rate of an organism or population.

Modern definition of Evolution—A change in the allele frequency/genetic makeup of a population

over time. The theory of evolution is supported by multiple lines of evidence.

Microevolution—a change in the allele frequency within a population thathappens over a short period of time.

Microevolution leads to changes within the group, but does not lead to speciation.

Macroevolution—major evolutionary change over time which leads to speciation.

Natural Selection--the process whereby organisms better adapted to their environment tend to survive and

produce more offspring. The theory of its action was first fully expounded by Charles Darwin and is now

8

believed to be the main process that brings about evolution. Natural selection is sometimes referred to as

Darwin’s mechanism of evolution.

Artificial Selection (selective breeding)--is a form of selection in which humans actively choose which

traits should be passed onto offspring. Through this process, humans affect variation in other, non-human

species. Humans used selective breeding long before Darwin's Postulates and the discovery of genetics.

Farmers chose cattle with beneficial traits such as larger size, and made them breed; and although they may

have known nothing about genes, they knew that the beneficial traits could be heritable. The farmers

selected for certain traits in their cattle and noticed that the offspring were becoming more and more

productive with each generation. Artificial selection is essentially a human caused type of evolution.

There have been situations in which artificial selection has backfired or caused negative outcomes. Some

of these include:

A. Insecticide use selects for insects that are resistant/tolerant of the insecticide. The use of insecticides has led

to the creation of “super bugs”.

B. The use of antiviral drugs has selected for versions of the HIV virus that are resistant to the drugs. This has

caused resistant strains of HIV to become more common.

C. MRSA and other antibiotic resistant bacteria are selected for during antibiotic treatment of diseases. Some

bacterial diseases like tuberculosis and MRSA are now very hard to treat

Patterns of Selection

Stabilizing Selection-- Stabilizing selection occurs when individuals at the extremes of the range of a characteristic

are consistently selected against. This kind of selection is very common. If the environment is stable, most of the

individuals show characteristics that are consistent with the demands of the environment. For example, for many

kinds of animals, there is a range of color possibilities. Suppose a population of mice has mostly brown individuals

and a few white or black ones. If the white or black individuals are more conspicuous and are consistently more

likely to be discovered and killed by predators, the elimination of the extreme forms will result in a continued high

frequency of the brown form. Many kinds of marine animals, such as horseshoe crabs and sharks, have remained

unchanged for thousands of years. The marine environment is relatively constant and probably favors stabilizing

selection.

Directional Selection-- Directional selection occurs when individuals at one extreme of the range of a characteristic

are consistently selected for. This kind of selection often occurs when there is a consistent change in the

environment in which the organism exists. For example, when a particular insecticide is introduced to control a

certain species of pest insect, there is consistent selection for individuals that have alleles for resistance to the

insecticide. Because of this, there is a shift in the original allele frequency, from one in which the alleles for

resistance to the insecticide were rare to one in which most of the population has the alleles for resistance. Similarly,

changes in climate, such as long periods of drought, can consistently select for individuals that have characteristics

that allow them to survive in the drier environment, and a change in allele frequency can result.

Disruptive or Diversifying Selection-- Disruptive selection occurs when both extremes of a range for a

characteristic are selected for and the intermediate condition is selected against. This kind of selection is likely to

happen when there are sharp differences in the nature of the environment where the organisms live. For example,

there are many kinds of insects that feed on the leaves of trees. Many of these insects have colors that match the

leaves they feed on. Suppose the species of insect ranges in color from light green to dark green, and medium green

is the most common. If a particular species of insect had some individuals that fed on plants with dark green leaves,

whereas other individuals fed on plants with light green leaves, medium green insects could be selected against and

the two extremes selected for, depending on the kind of plant they were feeding on.

9

Population Genetics

Populations evolve, individuals do not.

Population genetics is the science that studies the trait variation rates over time within a population.

It basically is following allele frequency rates in a gene pool. (A.K.A. a population.)

10

A population is defined by four criteria:

A. SAME species of organism.

B. Located in the SAME location.

C. At the SAME time.

D. And showing signs of reproduction. (Offspring are present within the group.)

Hardy-Weinberg Equilibrium

Hardy Weinberg /Genetic Equilibrium—a theoretical condition in which a population's

genotype and allele frequencies will remain unchanged over successive generations. Essentially,

evolution is not occurring. The Hardy-Weinberg model can be used to describe and predict

allele frequencies in a nonevolving population.

In order for Hardy-Weinberg equilibrium to be achieved, the five requirements listed below must apply to the

population.

Requirements for Hardy-Weinberg Equilibrium

1. No mutations. Germ cell mutations bring about evolution. Somatic cell mutations are not

passed on to offspring.

2. No immigration or emigration. (No gene flow)

3. There must be a very large population in order to avoid genetic drift.

Genetic Drift—unpredicted changes in allele frequencies due to chance. Usually occurs in small,

isolated populations.

4. There must be no natural selection.

5. There must be no sexual selection. Mating must be random.

So if the above conditions are met, no evolution occurs. This also means that if any of the conditions are not met,

evolution can/will occur. We can think of mutation, immigration/emigration/gene flow, genetic drift, natural

selection, and sexual selection/non-random mating as mechanisms of evolution.

Mutations occur randomly. Mutations result in the formation of new alleles/increased genetic variation within the

population. This provides new phenotypes on which natural selection acts. If a random mutation gives an

individual a phenotype which is advantageous in a particular environment, it will be selected for and will contribute

to the evolution of the population.

The movement of alleles between populations caused by migration/gene flow can also drive evolution.

Hardy Weinberg Equations

The Hardy-Weinberg equation is a mathematical equation that can be used to calculate the genetic variation of a

population at equilibrium. In 1908, G. H. Hardy and Wilhelm Weinberg independently described a basic principle of

population genetics, which is now named the Hardy-Weinberg equation. The equation is an expression of the

principle known as Hardy-Weinberg equilibrium, which states that the amount of genetic variation in a population

will remain constant from one generation to the next in the absence of disturbing factors.

To explore the Hardy-Weinberg equation, we can examine a simple genetic locus (location) at which there are two

alleles, A and a. The Hardy-Weinberg equation is expressed as:

2 2

p+ 2pq + q= 1 (genotype frequency equation)

where p is the frequency of the "A" dominant allele and q is the frequency of the "a" recessive allele in the

2 2

population. In the equation, prepresents the frequency of the homozygous dominant genotype AA, qrepresents the

11

frequency of the homozygous recessive genotype aa, and 2pq represents the frequency of the heterozygous genotype

Aa. In addition, the sum of the allele frequencies for all the alleles at the locus must be 1, so p + q = 1 (allele

frequency equation). If the p and q allele frequencies are known, then the frequencies of the three genotypes may

be calculated using the Hardy-Weinberg equation. In population genetics studies, the Hardy-Weinberg equation can

be used to measure whether the observed genotype frequencies in a population differ from the frequencies predicted

by the equation.

The Hardy Weinberg equations can only be used if the studied population is in genetic equilibrium. Do not

attempt to use the equations to calculate allele frequencies for populations that are evolving.

Genetic Drift

Genetic Drift-- Random fluctuations in the frequency of the appearance of a gene in a small isolated population,

presumably owing to chance rather than natural selection. These are non-selective processes.

Types of Genetic Drift

The Founder Effect—A founder effect occurs when a new colony is started by a few members of the original

population. This small population size means that the colony may have:

reduced genetic variation from the original population.

a non-random sample of the genes in the original population.

For example, the Afrikaner population of Dutch settlers in South Africa is descended mainly from a few

colonists. Today, the Afrikaner population has an unusually high frequency of the gene that causes

Huntington's disease, because those original Dutch colonists just happened to carry that gene with an

unusually high frequency.

12

Bottleneck Effect—genetic drift resulting from the reduction of a population due to a natural disaster/human

activity. The new population is not representative of the original population. Northern elephant seals have

reduced genetic variation probably because of a population bottleneck humans inflicted on them in the 1890s.

Hunting reduced their population size to as few as 20 individuals at the end of the 19th century. Their

population has since rebounded to over 30,000 — but their genes still carry the marks of this bottleneck: they

have much less genetic variation than a population of southern elephant seals that was not so intensely

hunted.

Genetic drift can result in a decrease in genetic variation within a given population. This decrease in

variation can increase the differences between populations of the same species.

Small populations with less genetic variability are more susceptible to random environmental impacts and

less able to adapt to them than are larger populations with more genetic variability.

Patterns of Evolution

Coevolution—Coevolution occurs when closely interacting species exert selective pressures on each other, so that

they evolve together in a kind of conversation of adaptations. Examples of coevolution predator/prey relationships,

the relationships between plants and their pollinators, and the relationships between parasites and their hosts.

Hummingbirds are a good example of pollinators that have coevolved with plants for mutual benefit. The

hummingbirds serve as pollinators and the flowers supply the birds with nutrient-rich nectar. The flowering plants

attract the hummingbirds with certain colors, the shape of the flower accommodates the bird’s bill, and such flowers

tend to bloom when hummingbirds are breeding. Coevolution of such flowering plants with various hummingbird

species is evident by the distinct shape and length of the flower’s corolla tubes, which have adapted to the shape and

length of the hummingbird bill that pollinates that plant.

Divergent Evolution—Divergent evolution occurs when adaptation to new habitats results in phenotypic

diversification. It is essentially a process in which a trait held by a common ancestor evolves into different

variations over time. A good example of divergent evolution is the evolution of vertebrate limbs. Whale flippers,

frog forelimbs, bird wings, and human arms all evolved from the front flippers of a fish-like ancestor as populations

of the organisms adapted to new environments. Because these limbs share a common evolutionary origin, they are

examples of homologous structures. An important consequence of divergent evolution is speciation, the divergence

evolution of one species into two or more descendent species. Speciation rates can be especially rapid during times

of adaptive radiation as new habitats/niches become available.

Convergent Evolution—Convergent evolution is the process in which species that are not closely related

independently evolve similar traits. This process occurs when similar selective pressures result in similar

phenotypic adaptations in different populations or species. For example, sharks and dolphins (which aren’t closely

related) have similar body shapes, body colors, and fins placements because those traits are important for success in

the environments/niches that the organisms both inhabit.

Speciation

Biological Species Concept—A species consists of genetically similar organisms that can interbreed and

produce viable, fertile offspring.

For speciation to occur, two populations must become reproductively isolated from each other.

– Over time, random mutations accumulate and are selected for or against.

– Given enough time, this process can cause the separated populations to diverge into different

species.

Types of Speciation

Allopatric Speciation—Two populations are separated by a geographical barrier. This reproductively

13

isolates the two groups from each other and leads to speciation.

Illustrative Example of Allopatric Speciation: When Arizona's Grand Canyon formed, squirrels and other

small mammals that had once been part of a single population could no longer contact and reproduce with

each other across this new geographic barrier. They could no longer interbreed. The squirrel population

underwent allopatric speciation. Today, two separate squirrel species inhabit the north and south rims of the

canyon.

Sympatric Speciation—Two populations live in the same geographic area, but are still reproductively isolated.

This is most common in plants and is usually due to polyploidy and/or hybridization

Illustrative Example of Sympatric Speciation: Roughly 180 years ago, some hawthorn fruit flies on the Eastern

coast of North America smelled the fruits on apple trees - a fairly recent import into that region from Europe - and

found them attractive. Today, nearly 2 centuries later, the flies have evolved into two distinct 'tribes'. One tribe,

called hawthorn flies, prefer to use native North American hawthorn fruit to lay their eggs on, while the other, called

apple flies attack crops of domesticated apples. Hawthorn flies and apple flies are considered to be two races of the

species complex Rhagoletis pomonella. The two races of flies maintain separate populations on the basis of

preferred host fruits, which they detect through smells - apple flies prefer apple scents, while hawthorn flies prefer

hawthorn fruit smells. Due to this reproductive isolation, the two groups of flies will continue to accumulate more

and more mutations and will become more and more different over time until they will eventually become two

distinct species.

Parapatric Speciation—Occurs when populations are separated not by a geographical barrier, such as a body of

water, but by an extreme change in habitat. While populations in these areas may interbreed, they often develop

distinct characteristics and lifestyles which inhibit interbreeding.

Illustrative Example: Plants which live around mines (in soils contaminated with heavy metals) have

experienced natural selection for genotypes that are tolerant of heavy metals. Meanwhile, neighboring plants

that don't live in polluted soil have not undergone selection for this trait. The two types of plants are close

14

enough that tolerant and non-tolerant individuals could potentially fertilize each other — so they seem to meet

the first requirement of parapatric speciation, that of a continuous population. However, the two types of plants

have evolved different flowering times. This change could be the first step in cutting off gene flow entirely

between the two groups. The groups are temporally isolated.

Adaptive Radiation

Adaptive radiation is a process in which organisms diversify rapidly from an ancestral species into a

multitude of new forms, particularly when a change in the environment makes new resources available, creates

new challenges, or opens new environmental niches. Starting with a recent single ancestor, this process results

in the speciation and phenotypic adaptation of an array of species exhibiting different morphological and

physiological traits.

Adaptive radiation may occur due to a combination of allopatric, parapatric, and/or sympatric speciation

events.

Adaptive Radiation Examples

15

2

0

Reproductive Isolating Mechanisms

Reproductive isolating mechanisms are a collection of evolutionary mechanisms such as behaviors and

physiological processes which are critical for speciation. They function to maintain reproductive isolation and

prevent members of different species from producing offspring or ensure that any hybrid offspring are sterile. These

barriers maintain the integrity of a species by preventing gene flow between related species.

They are generally categorized as either pre-zygotic or post-zygotic.

Pre-zygotic Isolating Mechanisms

Pre-zygotic isolating mechanisms prevent related species from forming zygotes with each other.

A. Habitat isolation - The organisms live in two different environments.

B. Behavioral Isolation – The “Mating Dances”/Mating behaviors are not recognized by the other.

C. Temporal (time) Isolation – They have different times of year they can reproduce.

D. Mechanical Isolation – The reproductive parts just don’t fit together correctly.

E. Gametic Isolation – The sperm and egg do not recognize each other.

Post-zygotic Isolating Mechanisms

Post-zygotic isolating mechanisms--mechanisms which act after fertilization to prevent successful inter-

population/species production of viable offspring.

A. Reduced Hybrid Viability – The hybrid organism can’t survive for long during development.

B. Reduced Hybrid Fertility – The hybrid organism survives, it just can’t reproduce.

16

Evidence for Evolution

The theory of evolution is supported by multiple lines of scientific evidence from many disciplines

(geographical, geological, physical, biochemical, and mathematical). Molecular, morphological (anatomical),

and genetic evidence from extant (living) and extinct organisms adds to our understanding of evolution and

supports the relatedness of all organisms in all domains.

Phylogeny or Phylogenetics—The evolutionary history of a species.

Morphological Homologous features/homologies—structures in different species that are similar because

of common ancestry (arm of a human, wing of bat, flipper of a whale). These structures have the SAME

STRUCTURE because the DNA “blueprint” is the same. Shared DNA/RNA/Protein Structure is the ultimate

homology. The similarity of DNA sequences is the most compelling evidence that scientists have to prove

the evolutionary relationships between organisms. There is a great deal of structural/morphological evidence

which indicates the common ancestry of all eukaryotic organisms. This evidence includes: A) all

eukaryotes possess membrane-bound organelles, B) All eukaryotes have linear chromosomes, C) All

eukaryotes have genes that contain introns (non-coding sections).

Analogous features—Similarity in two species due to convergent evolutionrather than to descent from a

common ancestor (wing of bird and wing of a mosquito). Does not imply common ancestry. Indicates

different solutions to the same evolutionary problem.

Vestigial organ—A morphological structure that is a historical/evolutionary remnant of a structure that was

important in evolutionary ancestors (appendix in humans, pelvis in a whale). Since snakes have a vestigial

pelvis, scientists think they evolved from a lizard ancestor.

Fossil Record—The fish/amphibian/reptile/bird/mammal fossil pattern found in rock strata over the entire

Earth is evidence that the different types of vertebrates evolved in that order. The fossil record also supports

the idea that populations continue to evolve because it shows continuous changes in the fossil record over

millions of years. Fossils can be dated by a variety of methods which include: a) using the age of the rocks

where the fossil is found, b) using the rate of decay of atomic isotopes like carbon-14, c) using geographical

data.

Comparative Embryology--the study of the similarities and differences among various organisms

during the embryologic period of development. Organisms with more similar embryonic development

patterns are more related than those with different patterns.

Comparative Biochemistry and Molecular Biology—Comparing the DNA,RNA, amino acid

sequences of proteins, and metabolic pathways of related organisms. Organisms who share these

characteristics must have inherited them from a common ancestor. Many fundamental

molecular/biochemical and cellular processes are conserved across organisms. For example, almost

all organisms use the same enzymes and metabolic pathways to carry out glycolysis, the Krebs Cycle,

and the electron transport chain. Most organisms also use the same or similar enzymes to carry out

the processes of DNA replication and protein synthesis.

Artificial Selection—evolution brought about by selective breeding (examples: dog breeds, crop plants). Man-

made evolution—Works much faster than natural evolution. The argument is that if humans can make

evolution happen, so can nature.

Direct Observation of Microevolution—Populations of organisms continue to evolve. Development of

antibiotic and pesticide/herbicide resistance have been witnessed within the last 75 years. These types of

evolution continue to happen at a very high rate. Scientists have also been able to observe the evolution

of the pathogens that continue to cause emergent diseases.

17

Biogeography--The geographic distribution of organisms on Earth follows patterns that are best

explained by evolution, in combination with the movement of tectonic plates over geological time. For

example, broad groupings of organisms that had already evolved before the breakup of the

supercontinent Pangaea (about 200 million years ago) tend to be distributed worldwide. In contrast,

broad groupings that evolved after the breakup tend to appear uniquely in smaller regions of Earth. For

instance, there are unique groups of plants and animals on northern and southern continents that can be

traced to the split of Pangaea into two supercontinents (Laurasia in the north, Gondwana in the south).

The evolution of unique species on islands is another example of how evolution and geography intersect.

For instance, most of the mammal species in Australia are marsupials (carry young in a pouch), while

most mammal species elsewhere in the world are placental (nourish young through a placenta).

Australia’s marsupial species are very diverse and fill a wide range of ecological roles. Because

Australia was isolated by water for millions of years, these species were able to evolve without

competition from (or exchange with) mammal species elsewhere in the world.

18

Types of Evolution

Gradualism--Gradualism is when evolution occurs slowly/gradually over thousands or millions of years. Over

a short period of time it is hard to notice. Small variations that fit an organism slightly better to its environment

are selected for: a few more individuals with more of the helpful trait survive, and a few more with less of the

helpful trait die. Very gradually, over a long time, the population changes. Change is slow, constant, and

consistent.

Punctuated Equilibrium--In punctuated equilibrium, change comes in spurts. There is a period of very little

change (stasis), and then one or a few huge changes occur, often through mutations in the genes of a few

individuals. Punctuated equilibrium can also occur due to sudden/cataclysmic changes in the environment that

result in more rapid changes in the organisms through harsher selection. Essentially, punctuated equilibrium is

when evolution occurs rapidly after long periods of stasis/stability. These rapid periods of evolution typically

occur after mass extinctions have provided newly available niches that can then be exploited by different

species.

Phylogenetic Relationships/Shared Ancestry

• Phylogeny--The history of the evolution of a species or group, especially in reference to lines of descent

and relationships among broad groups of organisms.

• Ways to establish phylogenetic relationships between organisms:

• Compare DNA/RNA sequences of specific genes. The more similar the sequences, the

19

more recently the organisms shared a common ancestor.

• Compare the amino acid sequences of specific proteins. The more similar the sequences, the

more similar the DNA/genes, the more recently the organisms shared a common ancestor.

• Compare morphology/shared derived traits. The more traits the organisms share, the more

recently they shared a common ancestor. Traits that are either gained or lost during

evolution can be used during the construction of phylogenetic trees/cladograms.

• Molecular data (like the comparison of DNA/RNA/amino acid sequences) provide

more accurate and reliable evidence than morphological traits for the construction

of phylogenetic trees/cladograms.

• Phylogenetic trees and cladograms represent hypotheses and are constantly being

revised, based on evidence (especially newly available DNA sequence comparisons).

Methods Used to Depict Phylogenetic Relationships

• Phylogenetic Tree--A branching treelike diagram used to illustrate evolutionary (phylogenetic)

relationships among organisms. Each node, or point of divergence, has two branching lines of descendance,

indicating evolutionary divergence from a common ancestor. A phylogenetic tree is drawn like a branching

tree diagram in which branch length is proportional to the evolutionary distance/time (as estimated from

the fossil record or a molecular clock) between organisms. This is not true in a cladogram. Cladograms do

not indicate time. Branch lengths are typically all the same length in a cladogram.

• Cladogram--A branching treelike diagram used to illustrate evolutionary (phylogenetic) relationships

among organisms. Each node, or point of divergence, has two branching lines of descendance, indicating

evolutionary divergence/speciation from a common ancestor. A cladogram is a type of phylogenetic tree.

Important Terms to

Know

• Clade--a group of biological taxa (such as species) that includes all descendants of one common

ancestor.

• Root--The initial ancestor common to all organisms within the cladogram. This is the point which

begins the cladogram.

• Morphology--a branch of biology dealing with the study of the form and structure of organisms and

their specific structural features.

• Shared Ancestral Trait--a trait shared by a group of organisms as a result of descent from a common

ancestor.

• Derived Trait/Derived Character--a trait that is present in an organism/group/lineage, but

was absent in the last common ancestor of the group/lineage being considered. Derived traits

that are shared by different lineages/groups indicate common ancestry and can be used in the

process of cladogram construction.

• Outgroup—An outgroup is a group of organisms that serves as a reference group when

determining the evolutionary relationships of the ingroup, the set of organisms under study.

The out-group represents the lineage/group that is least closely related to the remainder of the

organisms in the phylogenetic tree or cladogram. The evolutionary conclusion from these

20

relationships is that the outgroup species has a common ancestor with the ingroup that is older

than the common ancestor of the ingroup.

• Ingroup—The group of related species that are being studied/illustrated by the

cladogram/phylogenetic tree.

• Node-- Each node corresponds to a hypothetical common ancestor that speciated to give rise to

two (or more) daughter taxa. Cladograms can be rotated around each node without changing

the meaning/relationships depicted by the cladogram.

• Clade/Monophyletic Group-- A common ancestor and all of its descendants (i.e. a node and

all of its connected branches)

21

Constructing a Cladogram Based on Morphology

• Begin by constructing a character table like the one included on the proceeding slide. In the table use

a “1” to indicate that an organism possesses a trait and a “0” to indicate that an organism does not

possess the trait.

• The trait possessed by all of the organisms is the ancestral trait.

22

Character

Table

Constructing a Cladogram Based on Morphology

• Step 1: Draw a single right slanted line from the bottom left corner of your paper toward the top right-

hand corner of the page. At the top of the line, list the most complex group of organisms. This organism

should possess more of the shared derived traits than any of the other organisms. This line will be the

main evolutionary pathway or line.

• Step 2: Determine the first outgroup. This is the most primitive (oldest) group of organisms. It will share

only one of the traits (the ancestral trait) with the other taxa (clades) and therefore will be your first

outgroup. Just up from the root ofyour cladogram (bottom left corner) draw a left slanted line off of the

main line. At the top of the line write the name of the taxon of your first outgroup.

• Step 3: Just below and to the left of the outgroup line, draw a short horizontal line across the main line. At

the end of this small line, write the name of the ancestral trait, the trait shared by all of the organisms in the

cladogram.

• Step 4: Just above the outgroup line, draw a left slanted line that will show the next most primitive

group or second outgroup. List the group name at the end of the line. This group should possess only

the ancestral trait and one additional shared derived trait. These and all the other organisms that

evolved later are referred to as the ingroup .

23

• Step 4: Between the first outgroup line and the line drawn in Step 4, draw a small horizontal line across

the main line. At the right end of the small line, write the name of the shared derived trait that separates

the first outgroup from the first taxa in the ingroup.

• Step 6: Looking at the character table, decide the next group of organisms to become the next outgroup each

time. Draw another left leaning line for them and list their name at the end of the line. Be sure to use

horizontal lines across the main line to indicate the traits which separate the outgroups. Only traits shared by

all of the organisms above and to the right of the indicated line should be included on the main line.

• Step 7: Repeat until all groups of organisms have been listed or branched off of the main evolutionary line.

• Step 8: If you have two groups of organisms in the same outgroup, draw one left leaning line for the group.

Have a second right leaning line branching off of this left leaning line. On this second right leaning line,

draw a small horizontal line and list the separating trait here. (Just as you did on the main line.)

Using Molecular Evidence to Create Cladograms

• All organisms use DNA and RNA as genetic material and the genetic code by which proteins are

synthesized is (almost) universal.

• This shared molecular heritage means that nitrogenous base and amino acid sequences can be

compared to ascertain levels of relatedness.

• Over the course of millions of years, mutations will accumulate within any given segment of DNA.

• The number of differences between comparable base sequences demonstrates the degree of evolutionary

divergence.

• A greater number of differences between comparable base sequences suggests more time has passed

since two species diverged,

• Hence, the more similar the base sequences of two species are, the more closely related the two species

are expected to be.

• When comparing molecular sequences, scientists may use non-coding DNA, gene sequences or amino

acid sequences.

• Non-coding DNA provides the best means of comparison as mutations will occur more readily in these

sequences.

• Gene sequences mutate at a slower rate, as changes to base sequences may potentially affect

protein structure and function.

• Amino acid sequences may also be used for comparison, but will have the slowest rate of change due to

codon degeneracy.

• Amino acid sequences are typically used to compare distantly related species (i.e. different taxa), while

DNA or RNA base sequences are often used to compare closely related organisms (e.g. different

haplogroups – such as various human ethnic groups)

24

Using DNA sequence comparisons to construct a cladogram

The table included below contains the DNA sequences from the same gene from five related species. Calculate

the percent similarity of the sequences of species B-E compared to species A. Use this information to create a

cladogram. Place species A at the top right hand corner of our cladogram.

Species DNA SEQUENCE PERCENT SIMILARITY TO

SPECIES A

A ATGACGCGGTGTACGACCAG 100%

B ATGAGGCGGTGCCCGACCCT

C ATGAGGCGGTGTACGACCAG

D GGGAGGCGGTGCCCGACCCT

E ATGAGGCGGTGCCCGACCAG

Origins of Life on Earth

According to the geological evidence, Earth formed approximately 4.6 billion years ago, but the hostile

environment didn’t support the first life until about 3.9 billion years ago. The earliest known fossils date to 3.5

billion years ago. There are several models that seek to explain the origin of life on Earth.

A. The Oparin/Haldane Hypothesis

Oparin and Haldane proposed that the primordial sea served as a vast chemical laboratory powered by solar

energy. The atmosphere was oxygen free, and the combination of carbon dioxide, ammonia and ultraviolet

radiation gave rise to a host of organic compounds. The sea became a 'hot dilute soup' containing large

populations of organic monomers which served as the building blocks for the formation of more complex

molecules including amino acids and nucleotides. The joining of these organic monomers produced polymers

with the ability to replicate, store, and transfer information. Oparin and Haldane envisaged that groups of

monomers and polymers acquired lipid membranes, and that further developments eventually led to the first

living cells. The RNA World Hypothesis proposes that RNA could have been the earliest form of genetic

material. These first RNA molecules would have had to ability to replicate themselves without the help of

enzymes or other molecules. This hypothesis make sense, because not only can RNA store genetic information,

but it can also catalyze certain types of reactions (like enzymes). DNA eventually replaced RNA because it is

more stable and less susceptible to mutations.

Miller/Urey Experiment (Took place in 1953.)

Miller/Urey took inorganic substances that were thought to have been present in Earth’s early

atmosphere (H2O vapor, H2, NH3, CH4) and created organic amino acids and oils. (CO2 and CH4

are not considered organic compounds, even though they contain Carbon.) Miller wanted to show that

organic molecules, which are necessary for life, could be created by non-living things. This

experiment helped to support the Oparin/Haldane hypothesis.

25

B. Other scientists believe that the first organic molecules were brought to Earth on meteorites or by other

celestial events and that the arrival of these organic molecules led to the evolution of life on Earth. The

remains of several meteorites have been shown to contain diverse organic molecules, thus supporting this

hypothesis.

Extinction

Extinctions have occurred throughout Earth’s history. There is geological evidence which shows that there have

been at least 5 mass extinctions (events in which at least half of all species die in a relatively short period of time) in

Earth’s history. During the Ordovician-silurian extinction, many small marine organisms died out approximately

440 million years ago. During the Devonian extinction, many tropical marine species went extinct approximately

365 million years ago. The largest extinction in Earth’s history was the Permian-triassic extinction. During this

event (which occurred about 250 million years ago), 95% of marine species and 70% of terrestrial species went

extinct. The Triassic-jurassic extinction (210 million years ago) brought about the extinction of many land

vertebrates and allowed dinosaurs to flourish. Maybe the most famous mass extinction is the cretaceous-tertiary

extinction which occurred about 65.5 million years ago. This is the extinction event in which the dinosaurs were

killed.

Some scientists think that a sixth mass extinction, caused by humans, is currently in progress.

26

Extinction rates can be extremely rapid during times of ecological stress. These stresses and thus extinctions can be

caused by:

A. Sudden, massive volcanic activity. The volcanoes emit huge amounts of carbon dioxide which can

result in global warming. The dust and aerosols from the eruptions can also inhibit photosynthesis and

bring about the collapse of food chains.

B. Rapidly changing climate.

C. Asteroid/Comet impacts.

D. Anoxic events in which the middle and lower layers of the oceans become deficient in oxygen.

E. Changing positions of the oceans and continents/Changing of sea levels.

F. Human impacts can change ecosystems and cause extinctions.

The amount of biodiversity in an ecosystem is determined by the rates of speciation and extinction. High speciation

rates and low extinction rates increased levels of biodiversity, while low speciation rates and high extinction rates

lead to decreased levels of biodiversity.

Extinctions can provide newly available niches that can be exploited by different species. All of Earth’s mass

extinction events have been followed by periods of rapid evolution/speciation. Events such as this are the basis for

the idea of punctuated equilibrium.

Variations in Populations

A population’s ability to withstand environmental pressures and response to changes in the environment is

influenced by the population’s genetic diversity. Populations/species with little genetic diversity are at risk of

decline/extinction while those with high levels of genetic diversity are more able to adapt/evolve. Genetically

diverse populations are more resilient to environmental perturbations/disturbances because they are more likely to

contain individuals who can withstand the perturbation/disturbance.

Illustrative Example 1: In the 1800s, the Irish solved the problem of feeding a growing population of people by

planting a specific potato variety, the “lumper”. Since potatoes can propagate asexually, all of the lumpers were

clones and were genetically identical to each other. The lumpers were all genetically susceptible to a rot caused by

the fungus Phyotphthora infestans. The rot quickly turns the potatoes into inedible slime. When the rot eventually

struck Ireland in the 1840s, the potato crop was decimated and one in eight Irish people starved. The disaster would

likely not have been nearly as bad if the Irish had planted several varieties of genetically variable potatoes. Some of

the potato plants would likely have possessed genes that allowed them to survive the rot and produce edible

potatoes. The more resistant varieties would then have been planted after the first outbreak of the rot and

subsequent outbreaks would have been prevented or limited.

Illustrative Example 2: With the development of antibiotics in the 1940s, scientists thought that the human race had

conquered bacterial disease. However, they quickly learned that bacterial populations can quickly evolve to become

resistant to antibiotics. What they learned is that genetic variability within a population acts as the raw material for

evolution. This genetic variability often arises from random mutations. In genetically diverse bacterial populations,

these mutations may:

1. Permit evolution of protein enzymes which destroy antibiotics. An example is the bacterial enzyme beta-

lactamase which destroys beta-lactam antibiotics such as penicillin and ampicillin. Most Staphylococcus

aureus carry genes for production of beta-lactamases and therefore are not killed in the presence of

penicillin.

2. Permit evolution of protein enzymes which chemically modify antibiotics or targets, inhibiting action of

antibiotics

3. Change the target of the antibiotic so the antibiotic can no longer bind to and inhibit function of the protein

4. Permit evolution of bacterial “pumps” which specifically pump out antibiotics if they enter the bacterium

27

When antibiotics are used, individual bacterial cells which randomly possess resistance-conferring mutations are

artificially selected for, while those without the mutations are killed off. Since bacteria reproduce so quickly and

have such short life spans, antibiotic resistance can evolve within very small time increments.

Illustrative Example 3: About 12,000 years ago, an extinction event wiped out almost the entire cheetah population.

A handful of cheetahs managed to survive and were eventually able to restore the world’s population. The

population bottleneck/extinction event caused an extreme reduction in the cheetah species’ genetic diversity. The

resulting genetic homogeneity of today’s cheetahs has led to poor sperm quality, susceptibility to the same infectious

diseases, kinked tails, and tooth/jaw disease throughout the population.