Page 1: Restriction Enzyme Analysis: Introduction

Overview of Restriction Enzymes

• Definition: Restriction enzymes are specialized enzymes derived from certain bacteria that act as "molecular scissors" to cut DNA at specific sequences.

• Function: They are used in genetic engineering and molecular biology to manipulate DNA for various applications.

Analyzing DNA Sequence

• DNA Sequence Example:

  • Uncut DNA: TGATCGTGGAATTCGATGATCGATGCTAGCTGAA

  • The sequence GAATTC (top strand) is identified and marked. Its reverse complement (CTTAAG) is noted as a common feature of restriction enzymes, recognized as palindromic sequences.

DNA Cutting Process

• Cutting Sequence:

  • Cut Result: After cutting with the restriction enzyme, the DNA is divided into two fragments:

    • Piece 1: TGATCGTGG

    • Piece 2: AATTCGATGATCGATGCTAGCTGAA

• Procedure:

  1. Mix uncut DNA with restriction enzyme.

  2. Incubate in a hot water bath at the enzyme's optimal temperature for 30-60 minutes.

  3. Heat the mixture to denature the enzyme and halt the reaction.

  4. Use micropipette to transfer the DNA fragments for Gel Electrophoresis Analysis.

Page 2: Restriction Enzyme Analysis: Questions

Questions

1. Purpose of Restriction Enzymes:

   • Scientists use restriction enzymes to cut DNA at specific sites for cloning, genetic engineering, and analyzing genetic material.

2. Visualization Technique:

   • Scientists use Gel Electrophoresis to visualize newly cut DNA fragments.

3. DNA Fragments Calculation:

   • Analyze given sequences to determine how many fragments result from enzyme action on the uncut DNA.

     • Uncut DNA 1 Example:

       • Sequence: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA

       • Result: [Circle DNA fragments created by cutting at GAATTC. Determine number and length of fragments.]

   • Repeat for Uncut DNA 2 and Uncut DNA 3.

4. Matching Unknown Samples:

   • Compare the DNA fragments obtained from the unknown sample to known samples using the same restriction enzyme. Matching fragments indicate similarity.

Page 3: The Mysterious Death of Mr. Bawdee

Investigation Overview

• Scenario: Private investigator probes Mr. Bawdee's murder, armed only with DNA evidence from party attendees and possible murder weapons.

• Suspects: Professor Plum, Miss Scarlett, Colonel Mustard.

• Murder Scene: Dining Room; victim suffered blunt force trauma.

DNA Samples Collected

• From Weapons: Wrench, Candle Stick, Lead Pipe.

• From Victim and Suspects: Samples collected and prepared for analysis.

Analysis Process

• Restriction Enzyme Usage: Digest DNA samples with restriction enzymes that target the GAATTC sequence.

• Gel Electrophoresis: Compare the DNA fragment patterns among the samples.

  • Expected Outcome: Identical fragment sizes between the victim and suspect D.N.A implies possible matches.

Conclusion

• Determine the murderer and the murder weapon based on DNA fragment matches from gel results.

  • Example: Mr. Bawdee was killed by __________ (suspect) with the _________ (weapon).

Page 4: Who's the Daddy: Elephant Edition

Scenario Description

• As an animal caretaker, monitor animals’ health. Discovery of pregnancy in a female elephant, Ellie.

• Birth of male elephant, Elmer; DNA samples taken for paternal identification.

Analysis of DNA Samples

• Parent and Offspring DNA: Samples from Ellie (mother) and potential fathers (5 eligible males).

• DNA Fragment Analysis: Use restriction enzymes to compare Elmer’s DNA with Ellie’s and potential fathers.

Conclusion

• Identify Elmer's father; Any unique fragments in Elmer would indicate paternity amongst the eligible males based on fragment pattern comparison.

  • Example: The father of baby Elmer is ___________________.

Page 5: The Cicada Conundrum

Overview of Cicada Life Cycle

• Cicada Nymphs: Emerging annually after underground living for periods of 1-2 years.

• 17-year Cicadas: These have synchronized emergences and live underground for longer periods.

Nymph Study Objective

• As an entomologist, investigate if 17-year cicadas are present in the area by collecting and analyzing nymph samples.

DNA Analysis Method

• PCR and Gel Electrophoresis: Specific genetic segment (buzzer) isolated to differentiate between annual and 17-year cicadas.

  • Length: 300 base pairs for annual, 500 for 17-year species.

Findings and Summary

1. Identify nymphs by fragment sizes to determine species.

   • List nymphs as annual or 17-year cicadas based on DNA fragment analysis.

Page 6: Extended Study and Findings

Larger Scale Study

• Conduct a comprehensive backyard study to collect more nymph samples (300 found).

• PCR and Gel Electrophoresis Outcomes:

  • Results show the number of samples with specific length segments present.

Data Interpretation

1. Number of samples with 300 bp (annual): 120; 500 bp (17-year): 170.

2. Data Suggestion: Majority of 17-year cicadas; likely to outnumber annuals in the next emergence cycle.

Troubleshooting Data Loss

• Explain possible reasons for missing bands in gel electrophoresis:

  • 9 samples show no bands; this indicates potential issues in DNA extraction or degradation.

  • 1 sample with an 800 bp band; possibly contaminated or from a different species.