Restriction+Enzymes+and+Gels+practice

Page 1: Restriction Enzyme Analysis: Introduction

Overview of Restriction Enzymes

  • Definition: Restriction enzymes are specialized enzymes derived from certain bacteria that act as "molecular scissors" to cut DNA at specific sequences.

  • Function: They are used in genetic engineering and molecular biology to manipulate DNA for various applications.

Analyzing DNA Sequence

  • DNA Sequence Example:

    • Uncut DNA: TGATCGTGGAATTCGATGATCGATGCTAGCTGAA

    • The sequence GAATTC (top strand) is identified and marked. Its reverse complement (CTTAAG) is noted as a common feature of restriction enzymes, recognized as palindromic sequences.

DNA Cutting Process

  • Cutting Sequence:

    • Cut Result: After cutting with the restriction enzyme, the DNA is divided into two fragments:

      • Piece 1: TGATCGTGG

      • Piece 2: AATTCGATGATCGATGCTAGCTGAA

  • Procedure:

    1. Mix uncut DNA with restriction enzyme.

    2. Incubate in a hot water bath at the enzyme's optimal temperature for 30-60 minutes.

    3. Heat the mixture to denature the enzyme and halt the reaction.

    4. Use micropipette to transfer the DNA fragments for Gel Electrophoresis Analysis.

Page 2: Restriction Enzyme Analysis: Questions

Questions

  1. Purpose of Restriction Enzymes:

    • Scientists use restriction enzymes to cut DNA at specific sites for cloning, genetic engineering, and analyzing genetic material.

  2. Visualization Technique:

    • Scientists use Gel Electrophoresis to visualize newly cut DNA fragments.

  3. DNA Fragments Calculation:

    • Analyze given sequences to determine how many fragments result from enzyme action on the uncut DNA.

      • Uncut DNA 1 Example:

        • Sequence: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA

        • Result: [Circle DNA fragments created by cutting at GAATTC. Determine number and length of fragments.]

    • Repeat for Uncut DNA 2 and Uncut DNA 3.

  4. Matching Unknown Samples:

    • Compare the DNA fragments obtained from the unknown sample to known samples using the same restriction enzyme. Matching fragments indicate similarity.

Page 3: The Mysterious Death of Mr. Bawdee

Investigation Overview

  • Scenario: Private investigator probes Mr. Bawdee's murder, armed only with DNA evidence from party attendees and possible murder weapons.

  • Suspects: Professor Plum, Miss Scarlett, Colonel Mustard.

  • Murder Scene: Dining Room; victim suffered blunt force trauma.

DNA Samples Collected

  • From Weapons: Wrench, Candle Stick, Lead Pipe.

  • From Victim and Suspects: Samples collected and prepared for analysis.

Analysis Process

  • Restriction Enzyme Usage: Digest DNA samples with restriction enzymes that target the GAATTC sequence.

  • Gel Electrophoresis: Compare the DNA fragment patterns among the samples.

    • Expected Outcome: Identical fragment sizes between the victim and suspect D.N.A implies possible matches.

Conclusion

  • Determine the murderer and the murder weapon based on DNA fragment matches from gel results.

    • Example: Mr. Bawdee was killed by __________ (suspect) with the _________ (weapon).

Page 4: Who's the Daddy: Elephant Edition

Scenario Description

  • As an animal caretaker, monitor animals’ health. Discovery of pregnancy in a female elephant, Ellie.

  • Birth of male elephant, Elmer; DNA samples taken for paternal identification.

Analysis of DNA Samples

  • Parent and Offspring DNA: Samples from Ellie (mother) and potential fathers (5 eligible males).

  • DNA Fragment Analysis: Use restriction enzymes to compare Elmer’s DNA with Ellie’s and potential fathers.

Conclusion

  • Identify Elmer's father; Any unique fragments in Elmer would indicate paternity amongst the eligible males based on fragment pattern comparison.

    • Example: The father of baby Elmer is ___________________.

Page 5: The Cicada Conundrum

Overview of Cicada Life Cycle

  • Cicada Nymphs: Emerging annually after underground living for periods of 1-2 years.

  • 17-year Cicadas: These have synchronized emergences and live underground for longer periods.

Nymph Study Objective

  • As an entomologist, investigate if 17-year cicadas are present in the area by collecting and analyzing nymph samples.

DNA Analysis Method

  • PCR and Gel Electrophoresis: Specific genetic segment (buzzer) isolated to differentiate between annual and 17-year cicadas.

    • Length: 300 base pairs for annual, 500 for 17-year species.

Findings and Summary

  1. Identify nymphs by fragment sizes to determine species.

    • List nymphs as annual or 17-year cicadas based on DNA fragment analysis.

Page 6: Extended Study and Findings

Larger Scale Study

  • Conduct a comprehensive backyard study to collect more nymph samples (300 found).

  • PCR and Gel Electrophoresis Outcomes:

    • Results show the number of samples with specific length segments present.

Data Interpretation

  1. Number of samples with 300 bp (annual): 120; 500 bp (17-year): 170.

  2. Data Suggestion: Majority of 17-year cicadas; likely to outnumber annuals in the next emergence cycle.

Troubleshooting Data Loss

  • Explain possible reasons for missing bands in gel electrophoresis:

    • 9 samples show no bands; this indicates potential issues in DNA extraction or degradation.

    • 1 sample with an 800 bp band; possibly contaminated or from a different species.