Transcription - Genetics

rRNA, mRNA, tRNA, and Transcription:

• rRNA: Ribosomal RNA (rRNA) is a structural component of the ribosome and accounts for less than 5% of cellular RNAs.

• mRNA: Messenger RNA (mRNA) carries genetic information from DNA to the ribosome for protein synthesis.

• tRNA: Transfer RNA (tRNA) translates the genetic code from mRNA into amino acid sequences during translation.

• DNA Coding Strand: The coding strand is similar to mRNA (except with thymine instead of uracil).

• Prokaryotic vs. Eukaryotic Promoter:

  • Prokaryotic: The promoter is located upstream of the gene and is recognized by RNA polymerase (RNAP) and sigma factors.

  • Eukaryotic: RNAP binds to the promoter and transcribes the gene into mRNA, involving transcription factors like TBP and TATA box.

1. Alternative Splicing:

• Eukaryotic: Alternative splicing is a process in eukaryotes where a single gene can give rise to multiple protein variants by splicing out different combinations of exons.

2. Operon (DNA) & Polycistronic RNAs:

• Prokaryotic: Operons are clusters of genes that are transcribed together into a single mRNA molecule (polycistronic). This arrangement allows for coordinated regulation.

  • Why Operons Evolved: Efficient regulation of genes that work together in metabolic pathways or other cellular functions.

3. Be able to draw: pre-mRNA vs. mature mRNA:

• Pre-mRNA: Contains both exons and introns.

• Mature mRNA: Contains only exons, after introns are spliced out. It also includes a 5' cap and a poly-A tail.

4. Exons vs. Introns (function of each):

• Exons: Coding regions that remain in the final mRNA and are translated into protein.

• Introns: Non-coding regions that are removed during splicing. They may have regulatory functions or influence gene expression.

5. 5' UTR (Untranslated Region) function:

• Function: The 5' UTR is involved in the regulation of translation initiation and may contain sequences that affect mRNA stability and localization.

6. 3' UTR (Untranslated Region) function:

• Function: The 3' UTR is involved in the regulation of mRNA stability, localization, and translation efficiency. It may contain binding sites for regulatory proteins and microRNAs.

7. 5' Cap function:

• Function: The 5' cap protects the mRNA from degradation, facilitates nuclear export, and is required for translation initiation.

8. Poly-A tail function:

• Function: The poly-A tail stabilizes the mRNA, aids in its export from the nucleus, and promotes translation.

9. Splicing function:

• Function: Splicing removes introns from pre-mRNA and joins exons together to form the mature mRNA. This occurs in the nucleus.

10. Alternative splicing (function and why do it?):

• Function: Allows for the production of multiple protein isoforms from a single gene.

• Why do it? It increases the diversity of the proteome and enables more complex gene regulation.

11. Splice site motifs:

• Motifs: Consensus sequences at the splice donor (5') and acceptor (3') sites guide the splicing machinery.

12. What is transcription? What enzyme does this?

• Transcription: The process of synthesizing RNA from a DNA template.

• Enzyme: RNA polymerase (RNAP) catalyzes the transcription process.

13. What is translation? What enzyme does that?

• Translation: The process of synthesizing proteins from mRNA at the ribosome.

• Enzyme: Ribosome, assisted by tRNA and translation factors.

14. Why do we say that genomic information flows in one direction? What is the one (viral) exception?

• One Direction: Genetic information flows from DNA to RNA (transcription) and RNA to protein (translation).

• Exception (Viral): Retroviruses (e.g., HIV) reverse transcribe RNA into DNA using reverse transcriptase.

15. How is the structure of RNA different from DNA?

• RNA: Single-stranded, ribose sugar, uracil instead of thymine.

• DNA: Double-stranded, deoxyribose sugar, thymine.

16. Three major classes of RNA:

1. mRNA: Carries genetic code for protein synthesis.

2. tRNA: Transfers amino acids to the ribosome.

3. rRNA: Structural component of the ribosome.

17. What is the role of each of the three classes of RNA?

• mRNA: Template for protein synthesis.

• tRNA: Carries amino acids to the ribosome for protein synthesis.

• rRNA: Forms the core structure of the ribosome and catalyzes protein synthesis.

18. What types of molecules bind to a promoter?

• a. To recruit RNAP: Transcription factors, including the sigma factor in prokaryotes and TBP (TATA-binding protein) in eukaryotes.

• b. To stop RNAP: Terminator sequences (Rho or Rho-independent mechanisms).

19. What brings the RNAP to the promoter in prokaryotes?

• Sigma factors bind to the promoter region and recruit RNA polymerase.

20. What brings the RNAP to the promoter in eukaryotes?

• Transcription factors bind to the promoter, such as TBP for the TATA box, which recruits RNA polymerase II.

21. What is a terminator?

A terminator is a DNA sequence that signals RNA polymerase to stop transcription.

22. Describe the structure of bacterial RNA polymerase:

• Composed of a core enzyme (α2ββ'ω) and a sigma factor that directs the enzyme to the promoter.

23. Compare rho-dependent and rho-independent transcription termination:

• Rho-dependent: The Rho protein binds to the RNA and moves along it to catch up with RNA polymerase and release it.

• Rho-independent: The RNA forms a hairpin loop that causes RNA polymerase to dissociate.

24. RNA sequence transcribed from the following DNA template:

• DNA template strand: 3' CATTGATATTAATTGCATTCTGATA 5'

• RNA sequence: 5' GUAACUAUAAUUAACGUAAGACAU 3'

25. Shared properties of DNA polymerases and RNA polymerases:

1. Both synthesize nucleic acids in a 5' → 3' direction.

2. Both use a template strand.

3. Both require nucleotide triphosphates as building blocks.

26. Differences between DNA and RNA polymerases:

1. RNA polymerase synthesizes RNA from a DNA template; DNA polymerase synthesizes DNA.

2. RNA polymerase does not need a primer; DNA polymerase requires a primer.

3. RNA polymerase works with RNA, while DNA polymerase works with DNA.

27. Transcription and translation coupling in prokaryotes:

In prokaryotes, transcription and translation are coupled because they occur simultaneously in the cytoplasm, allowing for rapid protein synthesis.

28. Polysomes in prokaryotes and eukaryotes:

• Prokaryotes: Polysomes are in the cytoplasm, where transcription and translation are coupled.

• Eukaryotes: Polysomes are in the cytoplasm, but transcription occurs in the nucleus before translation.

29. Eukaryotic vs. prokaryotic transcription initiation differences:

• Eukaryotes: Requires transcription factors, enhancers, and a TATA box.

• Prokaryotes: Uses sigma factors to bind RNA polymerase directly to the promoter.

30. Which RNA polymerase in eukaryotes makes mRNAs?

RNA polymerase II synthesizes mRNA in eukaryotes.

31. TATA box function and transcription factor:

• The TATA box is a promoter region recognized by the TATA-binding protein (TBP) to initiate transcription.

32. Would a normal eukaryotic promoter work for expression in E. coli?

No, E. coli lacks the necessary transcription factors (e.g., TBP) to recognize and bind the eukaryotic promoter.

33. Why is RNA repair not needed?

RNA is transient