Genomics - Week 1 Lecture 1

Genomics

• Study of the structure, function, and evolution of genomes.

Genome

• The entire set of DNA of an organism.

• Can be found in eukaryotic and prokaryotic cells.

Questions Addressed with a Genome

• Structural Genomics: Physical structure, DNA sequence, location of specific elements.

• Functional Genomics: Gene expression, biological function of genes.

• Comparative Genomics: Comparison across species, evolutionary relationships, conserved regions, evolution of traits.

Genome Appearance

• Genomicists view it as a DNA sequence (e.g., GATCAATGAGGTGGACACCAGAGGCGGGGA…). Textbooks represent it as DNA sequence and Karyotype. Inside the cell, it appears as chromosome territories.

Obtaining a Genome Sequence

• Lab: Obtain DNA sequence from organism tissue using high-throughput sequencing.

• Bioinformatics: Reconstruct genome by assembling sequence data.

Need for Complete Genome

• Not always necessary depending on the specific goals (Structural, Functional, or Comparative Genomics).

Cost of Human Genome Sequencing

• The cost has dramatically decreased over time, following a trend similar to Moore's Law.

• NIH National Human Genome Research Institute contributed to this.

Strategies for Sampling Subsets of the Genome

• Reduced-representation sequencing: Genome-wide data at a reduced cost, targeting coding and/or non-coding DNA.

Types of Reduced-Representation Sequencing

• Transcriptomes / RNAseq: Sequencing transcribed parts of the genome.

• Target enrichment: Sequencing conserved parts of the genome.

• Restriction-site associated DNA / RADseq: Sequencing random parts of the genome.

Consortia / Genome Projects

• Major goal of modern science: "a moonshot for biology, aims to sequence, catalog, and characterize the genomes of all of Earth’s eukaryotic biodiversity."

• Ag100 Pest is an example.