Topic 6-3 CRISPR, DNA fingerprint,barcoding
Page 1: BIOL 207 Overview
Molecular Genetics and Heredity
Topic 8: Techniques in Molecular Genetics
Introduction to molecular genetics techniques covering various methods used to manipulate and study DNA.
Page 2: Key Techniques
Main Techniques in Molecular Genetics
Locate a gene/DNA sequence
Remove/Copy DNA sequence
Visualize DNA
Store new DNA sequences
Edit any genome
Major Techniques
Recombinant DNA
Polymerase Chain Reaction (PCR)
DNA sequencing and DNA libraries
CRISPR/Cas genome editing
Capabilities and Advancements
Overview of significant advancements in modern molecular genetics.
Page 3: Expanded Techniques
Special Focus on Molecular Techniques
Reiteration of the techniques listed on the previous page with additional emphasis on:
DNA fingerprinting and DNA barcoding as important modern methods.
Page 4: CRISPR-Cas Background
Introduction to CRISPR
Origin of CRISPR discovered by microbiologists in 1993.
CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats.
Example sequence: CGTTGAAGCGTCCGAAATTACGCTTCAACG
Page 5: Discovery of Foreign Sequences
Expanding Understanding of CRISPR
In early-mid 2000s, recognition that spacers in CRISPR had DNA from foreign sources like bacteriophages and viruses.
Page 6: DNA Repair Proteins and CRISPR
Connection between CRISPR and DNA Repair
Discovery that proteins previously considered as DNA repair mechanisms were associated with CRISPR (Cas = CRISPR-associated proteins).
This breakthrough elucidated the functional role of the CRISPR-Cas system, leading to the 2020 Nobel Prize in Chemistry.
Page 7: The CRISPR-Cas System in Bacteria
Functionality of CRISPR-Cas
Evolved Mechanism: Bacteria developed this system to fight off invading DNA elements (e.g., viruses), functioning like an immune response.
Memory Function: Acts as a memory of prior invaders, allowing targeted destruction in subsequent encounters.
Page 8: CRISPR Array Formation
Acquisition Phase of CRISPR
CRISPR arrays:
Comprised of protospacers (unique sequences from past invaders) and palindromic repeats.
Mechanism thus enables bacteria to "remember" past invaders effectively.
Page 9: RNA Expression in CRISPR
Expression Phase of CRISPR
Process of expressing complementary RNA to combat future invaders:
CRISPR array transcribed into a precursor RNA (Pre-crRNA).
Cleaved into short crRNA by Cas nuclease proteins.
Page 10: Targeting Invaders
Using Memory to Target DNA
Formation of Complexes: crRNA, tracrRNA, and Cas9 combine to target and destroy future invaders.
Page 11: Complex Binding and Cleavage
Mechanism of Action
CRISPR complex binds to the complementary DNA of new invaders, resulting in double-stranded breaks and DNA destruction.
Page 12: Targeting Specific DNA Sites
Specificity of Targeting
crRNA sequence crucially contains 20-50 nucleotides of invader homology.
Requires a Protospacer Adjacent Motif (PAM) site downstream for effective cleavage, typical sequence: 5’-NGG-3’.
Page 13: CRISPR-Cas9 System Overview
Genetic Applications and Innovations
CRISPR-Cas9 is a revolutionary genetic editing system that combines crRNA and tracrRNA into single guide RNA (sgRNA) for simplicity in targeting specific DNA sequences using the PAM sequence.
Page 14: Cleaved DNA Repair Mechanisms
Post-Cleavage Steps
Following cleavage, two primary repair mechanisms exist:
Nonhomologous end joining (NHEJ)
Homology directed repair (HDR)
Page 15: Nonhomologous End Joining
NHEJ Mechanism
Error-prone mechanism without a homologous template; leads to deletions, insertions, and random mutations.
Useful for creating disruptive mutations.
Page 16: Homology Directed Repair
HDR Mechanism
When homologous template present, allows insertion of new sequences into genes.
Commonly provides desired sequences into genes but has lower efficiency (1 in 100-1000 successful).
Page 17: CRISPR-Cas9 Challenges in Gene Therapy
Ethical Considerations
Two primary ethics-associated challenges:
Somatic gene therapy is generally viewed as ethically acceptable.
Germ-line gene editing is controversial due to potential heritable mutations.
Page 18: Delivery Mechanisms Complications
Challenges in Delivery
Methods include:
Viral Vector Delivery: Engineered viruses deliver gene editing components.
Non-Viral Delivery Vectors: Utilizing nanoparticles; effectiveness varies based on tissue targeting.
Page 19: Efficiency Concerns
Low Efficiency Across Tissues
CRISPR-Cas9 efficiency is often low (1 in 100-1000) raising questions about functionality restoration in edited tissues.
Page 20: Immunological Challenges
Reactions Against CRISPR Components
Potential immune responses triggered against Cas9 protein leading to autoimmune-like symptoms and reduced effectiveness in gene therapy applications.
Page 21: Off-Target Effects and Unknowns
Risks Associated with Gene Editing
Unknowns include off-target effects, where unintended parts of the genome may be altered, raising concerns for long-term safety and stability after editing.
Page 22: DNA Fingerprinting Techniques
Overview of DNA Profiling
Utilizes Short Tandem Repeats (STRs), varying significantly among individuals for identification purposes.
Page 23: Identification Based on Microsatellites
Identifying Individuals with STRs
Variability in STR numbers across individuals can be detected via PCR for forensic and genealogical identification.
Page 24: PCR Methodology
Primer Usage in PCR
Specific primers flank microsatellite regions to amplify these sections for analysis.
Page 25: PCR Product Characteristics
Size Variation Based on STRs
The length of PCR products varies according to the number of repeats in microsatellites.
Page 26: Gel Electrophoresis for Identification
Analysis of PCR Products
Running PCR reactions on a gel allows visualization of size differences in DNA bands, aiding in individual identification.
Page 27: Pattern Recognition in STR Loci
Unique Patterns of DNA Fragments
DNA fragment patterns across multiple STR loci are specific to individuals and suitable for forensic analysis.
Page 28: DNA Profiles and STR Analysis
Interpretation of DNA Profiles
Represents the output of PCR on specific STR loci; useful for distinguishing between homozygotes and heterozygotes.
Page 29: Forensic Application of DNA Fingerprinting
Application in Crime Scene Investigation
DNA fingerprinting aids in determining the presence of suspects at crime scenes by matching STR profiles.
Page 30: Historical Context of DNA Fingerprinting
Case Study: World Trade Center Victim Identification
DNA fingerprinting played a crucial role in identifying remains post-9/11 when traditional methods were ineffective.
Page 31: DNA Barcoding Identification
Identifying Species through DNA
Technique uses highly variable genes between species and low variability within species; COI mitochondrial gene commonly used for animals.
Page 32: Applications of DNA Barcoding
Practical Uses in Various Fields
Food species identification in markets/restaurants to ensure accurate labeling and prevent mislabeling.
Page 33: Broader Applications and Investigations
DNA Barcoding Utility
Identification of various species, tracking diets, analyzing remains, and monitoring invasive species can be facilitated through DNA barcoding.
Page 34: Historical Usage of DNA Barcoding
Investigative Applications
As per the CNN article, DNA barcoding has been vital in identifying species via genetic testing, with implications in ecological and legal contexts.
Page 35: DNA Barcoding Workflow Steps
Step-by-Step Process
Extract mystery DNA.
Amplify COI region with PCR.
Run PCR on Gel.
Sequence PCR product.
Identify species using DNA sequence databases.
Page 36: Genetic Approaches in Gene Function Studies
Two Main Approaches
Forward Genetics: Identify genes responsible for phenotypic traits from mutations.
Reverse Genetics: Initiate mutations in specific genes to observe phenotypic changes, ideal for understanding unknown gene functionality.
Page 1: BIOL 207 OverviewMolecular Genetics and HeredityTopic 8: Techniques in Molecular GeneticsIntroduction to molecular genetics techniques covers various methods and technologies used to manipulate, analyze, and study DNA sequences. These techniques enable researchers to investigate gene function, identify genetic variations associated with diseases, and develop new therapeutic strategies.
Page 2: Key TechniquesMain Techniques in Molecular Genetics
Locate a gene/DNA sequence: Methods for identifying the specific location of a gene within a genome.
Remove/Copy DNA sequence: Techniques such as gene cloning to obtain copies of specific genes.
Visualize DNA: Utilizing methods like gel electrophoresis to observe and analyze DNA fragments.
Store new DNA sequences: Techniques for preserving and characterizing new genetic information, including biobanking.
Edit any genome: Genome editing tools like CRISPR/Cas9 allow precise modifications at desired locations in the genome.
Major Techniques
Recombinant DNA: A method that involves combining DNA from different sources to create new genetic combinations.
Polymerase Chain Reaction (PCR): A widely used technique that amplifies specific DNA sequences through repeated cycles of denaturation, annealing, and extension.
DNA sequencing and DNA libraries: Techniques for determining the nucleotide sequence of DNA and constructing libraries to study gene expressions.
CRISPR/Cas genome editing: A revolutionary technology that allows for targeted modifications in the genome with high precision and efficiency.
Capabilities and AdvancementsThis section provides an overview of significant advancements in modern molecular genetics, highlighting the enhanced accuracy and effectiveness of gene editing and manipulation techniques that have paved the way for various applications, from agriculture to medicine.
Page 3: Expanded TechniquesSpecial Focus on Molecular TechniquesEmphasizing techniques like DNA fingerprinting and DNA barcoding, which play crucial roles in forensic science and biodiversity studies, respectively. DNA fingerprinting examines the unique patterns of short tandem repeats (STRs) in individuals, while DNA barcoding uses specific gene sequences (e.g., COI gene) to identify species.
Page 4: CRISPR-Cas BackgroundIntroduction to CRISPRCRISPR was discovered by microbiologists in 1993, originating as a defense mechanism in bacteria. CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats, signifying the presence of short repetitive DNA sequences that are critical for the system's function. An example sequence is CGTTGAAGCGTCCGAAATTACGCTTCAACG, which illustrates the organization and variability found within CRISPR arrays across different bacterial species.
Page 5: Discovery of Foreign SequencesExpanding Understanding of CRISPRIn the early to mid-2000s, researchers recognized that spacers within CRISPR arrays contained DNA sequences derived from foreign sources, such as bacteriophages and viruses. This discovery revealed how bacteria could adapt and respond to previous viral infections, laying the groundwork for understanding the immunological aspect of CRISPR.
Page 6: DNA Repair Proteins and CRISPRConnection between CRISPR and DNA RepairThe discovery that proteins previously identified as DNA repair mechanisms were associated with CRISPR (termed Cas proteins) elucidated the functional role of the CRISPR-Cas system. This significant finding contributed to the Nobel Prize in Chemistry awarded in 2020, acknowledging the importance of this system in genetic research and biotechnology innovation.