Proteins - these are arguably the most important constituent of cells, as they do a great many jobs (Fig. 5.13) in a variety of ways - among the cellular functions that proteins are involved in are: - structural: e.g. keratin - storage of amino acids: e.g. ovalbumin - cell signalling - effectors and receptors - movement: actin and myosin - defence against infection: antibodies - catalysis of chemical reactions: enzymes - proteins are polymers of amino acids, which are the first organic molecules made on earth 3.5 billion years ago - an amino acid consists of a carbon atom with the following covalently bonded to it: - a hydrogen atom - a carboxyl group - an amino group - an organic side chain (the R-group) which varies between the 20 known amino acids, and which gives each one it’s properties - within the aqueous environment of cell, the carboxyl and amino groups are both ionized (zwitterion) - 20 different amino acids are used in human cells - we synthesize 11 of them metabolically - the other 9 must be obtained through our diet (essential amino acids) - the R-group determines the chemical properties of the amino acid (Fig. 5.14) - non-polar - R-groups do not contain oxygen or nitrogen - these tend to make proteins less soluble in water - polar - R-groups contain oxygen, nitrogen (hydroxyl, amide) - these tend to make proteins more soluble in water - Note: sulphur is slightly more electronegative than hydrogen, so cysteine is considered a polar amino acid, but only weakly. Some classify it as non-polar. - charged - amino acids with a carboxy or amino group at the end of the R-group will ionize to take on a charge - acidic amino acids are negatively charged under normal cellular conditions - a carboxyl group ionizes to give up a hydrogen ion - basic amino acids are positively charged under normal cellular conditions - an amino group ionizes by taking up a hydrogen ion - polypeptides are made when amino acids are linked together with peptide bonds (Fig. 5.15) - a condensation/dehydration reaction occurs between the carboxyl group of one amino acid and the amino group of the next - a new monomer is always added to the carboxy-end (C-terminus) of the growing polypeptide chain - a polypeptide only becomes a protein when it is finished and functional - can be thought of as the “nipping and tucking” step - a protein’s function depends on its specific properties - exact amino acid sequence (primary structure) (Fig 5.18) - length: anywhere from 10 amino acids to 1,000 or more - usually has to be modified after the polypeptide is formed - may have to work in groups of related polypeptide chains - e.g. haemoglobin - even small changes to primary structure (mutation) can disrupt a protein’s function (Fig 5.19) - secondary structure - alpha (á) helix - coiling within a single polypeptide - pleated sheet - folding between two polypeptide chains lying in parallel - it is caused by H-bonding between carbonyl and amino groups along the backbone of the polypeptide (not the functional groups) - tertiary structure - the three-dimensional shape of the protein - tertiary structure is the key determinant in forming the functional areas on proteins (Fig 5.18) - active sites of enzymes - holds substrates in the right conformation - binding sites of adherins and regulatory proteins - tertiary structure is largely a result of interactions among amino acid functional groups - weak interactions - hydrophobic interactions - between non-polar amino acids; not dissimilar to fatty acid chains turning toward each other in a membrane - H-bonds - between polar amino acids - ionic bonds - between charged amino acids - covalent bonds - disulfide bridges - formed when two cysteine amino acids are positioned close together - these are strong bonds; the more disulfide bridges the protein has, the more it can survive unfavourable environmental conditions (e.g. very hot places) - primary structure determines the capacity for secondary and tertiary structure - quaternary structure - some polypeptides form associations with other polypeptides to make a functional unit - e.g. haemoglobin - two á-subunits bond with two â-subunits - subunit polypeptides typically joined via disulfide bridges, although weak interactions play a role as well - polypeptides must fold properly in order to be properly considered proteins - secondary, tertiary, and quaternary structure - often assisted by chaperonin proteins - even a change to a single amino acid MAY alter the folding of the protein enough that its activity may be altered or disrupted. - sickle-cell anaemia happens when an acidic glutamic acid is replaced by a non-polar valine (Fig. 5.19) on the beta-chain. - causes a hydrophobic pocket to open up, and the mutated proteins to aggregate, thus compromising the ability to carry oxygen - proteins are sensitive to their environment - they are affected by changes in such environmental variables as acidity, temperature, etc. - under normal conditions (e.g. within the cell), proteins retain their native conformation - too much acid, or too high will disrupt secondary and tertiary structure, as the weak interactions between amino acids are overwhelmed - denaturation (Fig 5.20) Nucleic acids - store and transmit hereditary information - primarily encode information for proteins - in most organisms, DNA (deoxyribonucleic acid) is used) - DNA is transcribed into RNA (ribonucleic acid) - RNA is translated into protein - this relationship is referred to as the central dogma of modern biology (Fig 5.22) - DNA consists of two polymer strands of deoxyribonucleotides - the two strands wind around each other in a helical format (double helix) - strands interact via hydrogen bonds - a single deoxyribonucleotide consists of: (Fig 5.23) - a deoxyribose sugar - hydroxyl group on the #2 carbon is missing - a phosphate group bonded to the #5 carbon of sugar - one of four nitrogenous bases - adenine (A) - guanine (G) - thymine (T) - cytocine (C) - both C and T have a small, monocyclic ring structure (pyrimidines) - both A and G have a larger, dicyclic ring structure (purines) - polynucleotide chain is synthesized by linking the #5 carbon and the #3 carbon on the sugar of adjacent nucleotides (Fig 16.5) - we’ll be looking at this process in some detail when we get to Chapter 16 - the linkage between the carbons of adjacent nucleotides in a single strand is a phosphodiester linkage - polymers extended by adding a nucleotide onto the #3 carbon at the end of the growing chain; dehydration reaction - “adding onto the 3' end” - each polynucleotide strand thus has a phosphodiester backbone - polynucleotide strands do not like to be single-stranded - nitrogenous bases are very prone to make H-bonds (Fig 16.8) - A makes hydrogen bonds with T - G makes hydrogen bonds with C - both occur when they are upside-down relative to each other - DNA occurs as a double strand - two strands are upside-down relative to each other (antiparallel) (Fig 16.7) - two strands are a mirror-image of each other (complementary) (Fig 16.7) - T nucleotide is across from every A nucleotide; and A across from T - G nucleotide is across from every C nucleotide; and C across from every G - chemical and physical properties of DNA cause it to coil into a helix (double helix) - discrete sections of DNA give the information for a specific protein (gene) (Fig. 17.5) - only one of the two strands in a gene is copied into RNA (template strand) - messenger RNA (mRNA) is also complementary and antiparallel to the template strand - RNA differs from DNA - ribonucleotides (not deoxyribonucleotides) are used - usually not double stranded (although it tries to be!) - not passed on when cells divide and to future generations - uses uracil instead of thymine - mistakes can be made when copying DNA (mutations) - these are transcribed by RNA, and result in changes to the primary sequence of the protein 3’ CATGTGGAATCGGGGCTCCTT 5’ 5’ GTCCACCTTAGCCCCGAGGAA 3’ ---------- The two strands separate.... 3’ CATGTGGAATCGGGGCTCCTT 5’ 5’ GTCCACCTTAGCCCCGAGGAA 3’ The two strands are copied.... 3’ CATGTGGAATCGGGGCTCCTT 5’ 5’ GTCCACC º » GGGCTCCTT 5’ 5’ GTCCACCTTAGCCCCGAGGAA 3’ ------------------ Base substitution mutation 3’ CATGTGGAATCGGGGCTCCTT 5’ 5’ GTCCACCTTAGCCCCGTGGAA 3’ 3’ CATGTGGAATCGGGGCTCCTT 5’ 5’ GTCCACCTTAGCCCCGAGGAA 3’ - note that the purine (A) has been replaced by a pyrimidine (T). This type of error is referred to as a transversion. - the base mismatch lasts for one cell generation -------------------- In the next round of replication, the strands separate and each one is replicated independently 3’ CATGTGGAATCGGGGCTCCTT 5’ 5’ GTCCACCT º » GGGGCACCTT 5’ 5’ GTCCACCTTAGCCCCGTGGAA 3’ ----------- The substitution becomes fully incorporated..... Normal 3’ CATGTGGAATCGGGGCTCCTT 5’ 5’ GTCCACCTTAGCCCCGAGGAA 3’ Mutant 3’ CATGTGGAATCGGGGCACCTT 5’ 5’ GTCCACCTTAGCCCCGTGGAA 3’ ------------------ Such base substitutions can result in a simple change to the polypeptide it encodes (Fig. 17.28) - The tendency for DNA, and thus proteins, to mutate makes them important tools in studying evolutionary biology - mutations occur at roughly regular intervals, and many of them have no effect on the function of the protein (selectively neutral) - these mutations will build up at a roughly steady pace - the longer two lineages have been separated, the more differences there will be in gene and protein sequence - it is the basis of the molecular clock in evolutionary studies.