16.1: Identification of Vaginal Stratified Squamous Epithelial Cells

• A normal human vagina is covered by the squamous mucosa, which is composed of stratified squamous epithelial tissue.

• Lying under the squamous mucosa is the submucosa, which contains an abundance of connective tissue and capillaries.

• Below the submucosa is the muscularis, which is made up of smooth muscle.

• The squamous mucosa consists of multiple layers of cells:

  • Basal Layer: In this layer, basal cells are anchored to the basement membrane that separates the squamous mucosa from the submucosa.

    • Basal Cells: Are small in size with relatively large nuclei and are highly proliferative.

  • Parabasal Layer: This is where cells undergo differentiation.

  • Intermediate Layer: The cells are flattened and their nuclei are compressed.

  • Superficial Layer: This is where the cells are fully differentiated with small and dense nuclei.

  

  

  

Lugol’s Iodine Staining and Periodic Acid–Schiff Method

• Lugol’s iodine solution: Named after the French physician Jean Lugol, is originally used as an antiseptic that is applied to skin or tissue to prevent infection.

• It is utilized for the identification of glycogenated vaginal epithelial cells.

• The technique is based on the principle that iodine reacts with intracellular glycogen to exhibit a color.

• Glycogen is the principal storage form of glucose in animal and human cells and is found in the granules in the cytoplasm of the cells of many tissues.

• In addition to squamous epithelial cells, glycogen is also found in hepatocytes, which have the highest glycogen content, as well as muscle cells.

• Lugol’s stock solution is an aqueous solution of 5% iodine (I2) and 10% potassium iodide (KI).

• Potassium iodide allows the iodine to be soluble in water through the formation of the triiodide ion.

Dane’s Staining Method

• Skin, buccal, and vaginal epithelial cells belong to stratified squamous epithelium.

• Differentiated skin epithelial cells are keratinized and are classified as keratinizing squamous epithelial cells, while buccal and vaginal epithelial cells are nonkeratinizing squamous epithelial cells.

• The skin epithelial cells lose nuclei and other cellular organelles during differentiation.

• Dane’s staining method has been developed to distinguish all three types of cells.

  • Skin cells are stained red and orange;

  • Buccal cells are stained predominantly orange-pink with red nuclei; and

  • Vaginal cells are stained bright orange with orange nuclei.

16.2: Identification of Vaginal Acid Phosphatase

• Acid phosphatases are a group of enzymes that are capable of hydrolyzing a variety of small organic phosphomonoesters under acidic conditions.

• Five different acid phosphatase isoenzymes identified in human tissues:

  • erythroid acid phosphatase;

  • lysosomal acid phosphatase;

  • prostate acid phosphatase;

  • macrophage acid phosphatase;

  • testicular acid phosphatase.

• Human prostatic acid phosphatase is found in large quantities in seminal fluid and is used as a biomarker for semen identification.

• Prostatic acid phosphatase: A homodimer containing two identical subunits with a molecular weight of 50 kDa. Small amounts of acid phosphatase can be detected in vaginal fluid, which is produced in normal cervical epithelial cells.

16.3: Identification of Vaginal Bacteria

• Lactobacillus: It can be found in the respiratory, the gastrointestinal, and the urogenital tract of healthy humans and animals.

• Lactobacillus taxa: These are the predominant bacteria in the vagina of women of reproductive age, and they play an important role in protecting the host against invasive pathogenic organisms.

• Lactobacillus consists of rod-shaped, nonmotile, and non-spore-forming gram-positive bacteria.

• Lactobacillus bacteria produce lactic acid.

16.4: Outlook for Confirmatory Assays of Vaginal Secretions

• Nondestructive confirmatory identification methods such as fluorescence spectroscopy and Raman spectroscopy can potentially be useful for the identification of vaginal secretions.

• The analysis of tissue-specific gene expression has been utilized for the identification of vaginal secretions.

• Using the reverse transcription polymerase chain reaction (RT-PCR) technique, the mRNAs of the tissue-specific genes of vaginal epithelial cells can be detected.

• The commonly used markers for vaginal secretion identification are:

  • MUC4: Encodes a mucin protein that is a major component of vaginal mucus.

  • HBD1: Encodes a vaginal antimicrobial peptide.

16.5: Menstruation

• Menstruation: The periodic discharge of blood and the elimination of the degenerated lining of the endometrium from the uterus of nonpregnant women.

• From menarche to menopause, women may menstruate up to 400 times during their reproductive age.

• The uterus plays an important role in preparing the uterine endometrium for the possible implantation of a developing embryo.

• The linings of the uterus are composed of the myometrium and the endometrium.

  • Myometrium: Consists of the muscle fibers of the uterus.

  • Endometrium: Consists of the simple columnar epithelium and the stroma.

• The endometrium consists of the simple columnar epithelium and the stroma.

  • Simple columnar epithelium: Formed by single-layered elongated cells located at the apical surface of the endometrium.

  • Stroma: It consists of connective tissues as well as spiral arteries.

• Spiral arteries: These are small arteries that ascend through the endometrium and form a coil-like structure, which supplies blood to the endometrium.

Representative Markers of mRNA-Based Assays for Vaginal Secretions and Menstrual Blood Identification

• Vaginal Secretions:

  • CYP2B7P1: Cytochrome P450, family 2, subfamily B, polypeptide 7, pseudogene 1.

  • DKK4: Dickkopf homolog 4

  • FUT6: Fucosyltransferase 6

  • HBD1: β Defensin 1

  • IL19: Interleukin 19

  • MUC4: Mucin 4

  • MYOZ1: Myozenin 1

  • SFTA2: Surfactant associated 2

• Menstrual blood:

  • MMP7: Matrix metalloproteinase 7

  • MMP11: Matrix metalloproteinase 11

miRNA Markers for Vaginal Secretions and Menstrual Blood Identification

• Vaginal secretions:

  • miR124a: UAAGGCACGCGGUGAAUGCC

  • miR372: AAAGUGCUGCGACAUUUGAGCGU

  • miR617: AGACUUCCCAUUUGAAGGUGGC

  • miR891a: UGCAACGAACCUGAGCCACUGA

• Menstrual Blood:

  • miR214: UGCCUGUCUACACUUGCUGUGC

  • miR412: ACUUCACCUGGUCCACUAGCCGU

  • miR451: AAACCGUUACCAUUACUGAGUU

Uterine Cycle

• The endometrium can be divided into two zones:

  • Functionalis: The luminal part of the endometrium. It is the zone of cyclic changes in the endometrium and is shed during menstruation.

  • Basalis: The basal part of the endometrium and is not shed during menstruation. This zone produces cells to regenerate the functionalis during the next cycle.

• During the uterine cycle, repetitive physiological changes occur in the functionalis.

• The cycle is divided into three phases:

  • During the menstrual phase, the functionalis degenerates and is sloughed off from the uterine wall and bleeding occurs, known as menses.

  • During the proliferative phase, the functionalis begins regeneration in which the spiral arteries are proliferated.

  • During the secretory phase, the spiral arteries are further developed and coiled.

• In the absence of pregnancy, a decrease in the progesterone level leads to the constriction of the spiral arteries. As a result, the functionalis becomes ischemic, leading to hypoxia.

Uterine Endometrial Hemostasis

• The cessation of menstrual bleeding is achieved by endometrial hemostasis that is initiated when injury occurs due to the shedding of the endometrium.

• Hemostasis begins with platelet activation and aggregation to form platelet plugs at the site of injury.

• The blood coagulation cascade is activated to produce thrombin.

• Thrombin: A serine protease, converts soluble fibrinogen into fibrin.

• Fibrin: A protein involved in blood clotting, aggregates with the platelet plugs and leads to the cessation of bleeding by forming blood clots, known as thrombi.

• Under normal physiological conditions, uterine endometrial hemostasis is a balanced process between blood coagulation and clot dissolution to control blood loss and to prevent clot accumulation within the uterus.

• Blood clots are prevented from accumulating during menstruation by forming low amounts of platelet plugs and synthesizing coagulation factor inhibitors that inhibit blood coagulation.

• Fibrinolysis is activated, during which the thrombus is broken down by a protease known as plasmin. Plasmin cleaves fibrin, generating soluble degradation products.

16.6: D-dimer Assay

• D-dimer: A degradation product produced during fibrinolysis when cross-linked fibrin is cleaved by plasmin.

• In ELISA, antibodies bind to the D-dimer antigens on the solid phase.

  • The D-dimer–antibody complex is subsequently analyzed using an antibody-based detection system. This method is highly sensitive, but is time-consuming.

• Latex agglutination assays are based on the interaction of antibodies and D-dimers that are located on carriers to form aggregates during the agglutination process.

• Immunochromatographic assays utilize monoclonal antibodies specific to D-dimers, which have been developed recently. It is very specific, sensitive, and rapid, and can be completed within minutes.

• Although peripheral blood contains low levels of D-dimer, these assays do not show positive reactions with peripheral blood.

• Menstrual blood can be distinguished from peripheral blood using D-dimer assays.

16.7: Lactate Dehydrogenase Assay

• Lactate dehydrogenase (LDH): An enzyme that plays an important role in glycolysis. It catalyzes the reversible reduction of pyruvate into lactate when the amount of oxygen is limited.

  • It is tetrameric enzyme consisting of three different types of subunits.

    • A subunit: It is encoded by the LDHA gene and is primarily expressed in skeletal muscle.

    • B subunit: It is encoded by the LDHB gene and is primarily expressed in cardiac muscle.

    • C subunit: It is encoded by the LDHC gene, is expressed restrictively in the testes.

  • LDHs are found in various human tissues. Five isoenzymes can be found in blood:

    • LDH1 consists of four identical B subunits;

    • LDH2 consists of one A and three B subunits;

    • LDH3 consists of two A and two B subunits;

    • LDH4 consists of three A and one B subunits; and

    • LDH5 consists of four identical A subunits.

  • According to their electrophoretic mobility, five bands can be identified.

    • LDH1 has the highest electrophoretic mobility.

    • LDH5 has the lowest electrophoretic mobility.

  • LDH1, 2, and 3 are the predominant forms of the isoenzymes in peripheral blood.

  • LDH4 and 5 are consistently the predominant isoenzymes in menstrual blood.

16.8: RNA-Based Assays

• Matrix metalloproteinase (MMP) genes are considered tissue-specific markers for human endometrium tissues.

  • These are zinc-dependent endopeptidases that degrade extracellular matrix components. They

• Extracellular matrix (ECM): The extracellular space of tissue that is filled by macromolecules such as collagens, laminins, fibronectins, and proteoglycans.

  • Interstitial Matrix: These matrices are located in the intercellular spaces.

  • Basement membrane: These are thin layers of macromolecule fibers that usually lie under the epithelium and the endothelium.

• The most commonly used markers for the forensic identification of menstrual blood are MMP7 and MMP11.

• The patterns of the MMP gene expressions are correlated with their functions in endometrium tissue breakdown during menstruation.

  • MMP7 is predominantly expressed in epithelial cells, while MMP11 is expressed in the stromal cells of the endometrium.

  • is also known that MMPs’ mRNA may be elevated in postpartum, wound healing, and metastatic cancer conditions, which may potentially lead to a false-positive identification of menstrual blood.

• In menstrual blood samples, MMP11 is the most sensitive and specific marker for distinguishing menstrual blood from peripheral blood.

  • MMP11 mRNA can be detected in menstrual blood from the first to the eighth day of menstruation but it is absent in peripheral blood and vaginal secretions.