W7_Proteins_StudentA

Page 1: Introduction to MCB 181R

• Topic: Ending discussion of the central dogma related to products of translation.

• Instructor: Dr. Corin Gray (pronouns: she/her/they/them).

• Course Week: 7 - Focus on Proteins.

Page 2: Course Modules

• Week 7/8 modules are now open.

• Importance of completing PlayPosits as soon as possible for troubleshooting.

• Note: No summaries will be accepted for PlayPosits.

• Videos include embedded questions for assessment.

Page 3: mRNA Translation Exercise

• Translate the following mRNA sequence: 5’ - ACAUGCCUAAAGUAUAGGGA - 3’

• Available Options:

  • A. THR-CYS-LEU-LYS-TYR-ARG

  • B. MET-PRO-LYS-VAL

  • C. THR-MET-PRO-LYS-VAL

  • D. MET-LYS-SER-VAL

• Suggestion: Write the translation before discussing with a peer ('shoulder buddy').

Page 4: mRNA Translation Details

• Focus on in vivo translation (within an organism).

• Identify the start codon (AUG) and stop codon (UAG) to determine polypeptide sequence.

Page 5: Overview of the Central Dogma

• Proteins have various functions:

  • Structure: e.g., collagen.

  • Catalysts: e.g., enzymes.

  • Transport: e.g., membrane channels.

  • Movement: e.g., actin and myosin.

  • Signaling: e.g., insulin.

  • Storage: e.g., ferritin.

• Mention of transcription enzyme: RNA polymerase.

Page 6: Learning Objectives

• Identify monomers in protein macromolecules and associated functional groups.

• Understand how sequence and biochemical properties affect protein structure and function.

• Analyze effects of temperature changes on protein structure and function.

• Predict outcomes of amino acid changes in proteins.

Page 7: Water Interactions

• Water is composed of covalently bonded hydrogen (H) and oxygen (O) atoms.

• Attractive non-covalent interactions occur due to hydrogen bonding:

  • Electronegativity of O attracts partially positive H atoms.

• Influence of water on protein folding includes hydrophilic and hydrophobic components.

Page 8: Amino Acids Structure

• Proteins consist of monomers called amino acids joined by peptide bonds.

• Structure of amino acids:

  • Central carbon atom (α carbon) bonded to:

    • Amino group.

    • Carboxyl group.

    • Hydrogen atom.

    • Side chain (R group).

• Peptide bonds form via dehydration synthesis (release of water).

Page 9: Unique Features of Amino Acids

• R groups (side chains) of amino acids make them unique, impacting chemical and physical properties.

Page 10: Similarity of R Groups and Nucleotide Bases

• True or False: R groups are similar to nucleotide bases as they define uniqueness and properties of monomers.

Page 11: Classification of Amino Acids

• 20 amino acids classified based on:

  • Interaction with water (hydrophilic vs hydrophobic).

  • Acidic or basic nature.

  • Polar or nonpolar character.

• Importance of characteristics in influencing protein structure and function.

• Reference to Fig. 5.2 on exam.

Page 12: Amino Acids in Protein Folding

• Apply understanding: Identify amino acids likely to be embedded in the interior of folded proteins.

  • Options: A. Arginine (Arg) B. Phenylalanine (Phe) C. Serine (Ser) D. Glutamic acid (Glu)

Page 13: Repeating Question on Amino Acids

• Repeat identification of amino acids likely embedded in protein interiors (same options as Page 12).

Page 14: Protein Structures

• Primary Structure: Linear amino acid sequence with covalent (peptide) bonds.

• Can be represented as one-letter or three-letter abbreviations.

• Sequence is read from N-terminus to C-terminus.

• Secondary Structure: Arises from hydrogen bonding between backbone atoms.

  • Examples: Alpha helices, beta sheets.

Page 15: Comprehensive Protein Structure Overview

• Tertiary Structure: Results from interactions between amino acid side chains.

• Folding determined by R group distribution.

• Chemical bonds and interactions shape tertiary structure.

Page 16: Tertiary Structure Visuals

• Three models to illustrate tertiary structure:

  • Space-filling model: Shows overall shape and contour.

  • Ribbon model: Highlights alpha helices and beta sheets.

  • Ball-and-stick model: Displays individual atoms in amino acid chain.

Page 17: Quaternary Structure

• Comprised of interactions between protein subunits:

  • Same types of interactions as tertiary structure (e.g., hydrogen bonds).

• Common terminology: dimer (2 subunits), trimer (3), tetramer (4), multimer (many).

• Differentiation between homo (same) and hetero (different) subunit assemblies.

Page 18: Impact of Protein Denaturation

• Loss of structure (secondary/tertiary) leads to function loss.

• Factors causing denaturation:

  • Disruption of hydrogen bonds and R group interactions.

  • Caused by extreme pH or high temperatures.

• Potential for refolding and regaining function under optimal conditions.

Page 19: Tertiary Structure Contributions

• Understanding bonds and interactions that contribute to tertiary structure:

  • A. H bonding within secondary elements.

  • B. Disulfide bonds (Cys).

  • C. Hydrophilic and hydrophobic interactions.

  • D. Both B and C contribute to tertiary structure.

  • E. All listed contribute to tertiary structure.

Page 20: Tertiary Structure Understanding Repeated

• Repeat question on contributions to tertiary structure (same options as Page 19).

Page 21: Experimental Evidence on Protein Structure

• Study of ribonuclease A enzyme to show amino acid sequence dictates structure:

  • Used urea and 2-mercaptoethanol to denature enzyme and disrupt bonds.

  • Recovered enzyme activity upon chemical removal.

  • Conclusion emphasizes that the protein sequence alone dictates folding.

Page 22: Group Work Instructions

• For full credit, submissions should include:

  • Answers for all levels of protein structure (Part A).

  • Two labeled drawings for Part B.

  • Full names of group members and section number.

• Gene effects: Example involving beta-globin and its relation to phenotypes (sickle-cell anemia).

  • Discussion of alleles GAG (Glu) and GUG (Val) impact.

Page 23: Group Work Review

• Discussion on structural changes due to amino acid mutation:

  • Primary Structure: Single amino acid change affects sequence, not structure.

  • Secondary Structure: H bond-driven changes possible.

  • Tertiary Structure: Affected by side chain interactions; Glu to Val impacts structure.

  • Quaternary Structure: Hemoglobin structure altered due to beta-subunit changes.

Page 24: Exit Ticket - Examples of Denaturation

• Understanding application: Identify real-world examples of protein denaturation:

  • A. Heat on hair.

  • B. Cooking an egg.

  • C. Curing salmon with lemon/lime.

  • D. Digestion.

  • E. All are examples of protein denaturation.

Page 25: Repeated Application Question

• Repeat question regarding real-world protein denaturation examples (same options as Page 24).