Honors Biology Unit 6 Final Examm

• Semi-Conservative Replication: where a new dna molecule is formed with one original strand and one newly synthesized strand

• DNA Polymerase: adds nucleotides to the 3’ end of the primer and continues until replication of that DNA section is complete, proofreads if the bases are paired correctly, and mismatch repair

• Lagging Strand: is syntheiszed discontinuously, forming small fragments of DNA called, Okazaki fragments, which require its own primer

• DNA->Transcription->mRNA->translation->Protein

• Transcription copies DNA into RNA, translation uses the mRNA as a template to synthesize proteins

Transcription

• 1. Initiation:
  RNA polymerase binds to a specific DNA sequence called the promoter, initiating transcription.

• 2. Elongation:
  RNA polymerase unwinds the DNA double helix and adds complementary RNA nucleotides to the growing mRNA strand.

• 3. Termination:
  RNA polymerase encounters a termination sequence, signaling the end of transcription and the release of the mRNA molecule.

• 4. RNA Processing:
  In eukaryotes, the pre-mRNA undergoes processing, including capping, polyadenylation, and splicing, to produce mature mRNA.

• 5. Transport:
  The mature mRNA is transported from the nucleus to the cytoplasm, where translation occurs. 

• Translation

• 1. Initiation:
  The ribosome binds to the mRNA at the start codon, initiating protein synthesis.

• 2. Elongation:
  tRNA molecules, carrying specific amino acids, bind to the mRNA codons, and the ribosome moves along the mRNA, adding amino acids to the growing polypeptide chain.

• 3. Termination:The ribosome reaches a stop codon, signaling the end of translation, and the completed polypeptide (protein) is released. 

• Practice Answer: mRNA:UACUAUGCCUAGUUUAGCGUGAGACCU: tRNA: AUGAUACGGAUCAAAUCGCACUCUGGA; Amino Acid sequence: STOP-Tyr-Ala-STOP-Phe-Ser-Val-Arg-Pro

• Promoter: where RNA polymerase will bind to begin transcription

• Terminator: signals the RNA polymerase to stop teanscribing the gene, marking the end of the process

• Start Codon: a three nucleotide sequence that indicates where protein translation should being. And then starts assembling amino acids into a polypeptide chain.

• Stop Codon: a three nucleotide sequence that signals the ribosome to stop translating the mRNA and releases the newly synthesized polypeptide chain

• Where are they found? Promoters and terminators are found on DNA, while start and stop codons are found on mRNA.

• RNA Splicing: RNA splicing occurs in the nucleus of eukaryotic cells. This is where they remove introns (non-coding regions) from pre-mRNA and joins together the exons (expressed regions)  to creates different proteins.

• How is it processed? A 5’ cap gets added to the 5’ end, a poly A tail is added to the 3’ end to assist in exportation from the nucleus, for stability, and prevents breakdown by ctoplasmic enYmes and splicing

• Mutagen: a outside agent that cause a genetic mutation. EX: high energy radiation

•  Mutations altering reading frames: it changes how the genetic code is read, leading to a completely different sequence of amino acids being produced

• What organisms use operons to produce? Prokaryotic cells use operons.

• Lac Operons vs. Trp Operons

  • Lac Operons:  these are inducible operons. They are normally inactive and must be actived (or induced/turned on) by inactivating the repressor protein

  • Trp Operons: these are repressible operons. They are normally activated and must be deactiveated (repressed) by activgatiing the repressor protein

• How do histones regulate gene expression? By influencing the accessiblity of DNA to transcriptional machinery. They do this through various post-traslational modifications, like acetylation and methylation

• Nucleosome: a section of DNa that is wrapped around a core of proteins (or chromatin)

• Barr Body: an inactivated X chromosome in mammals ; to prevent aneuploidy, one of the two X chromosomes in the female embryo is inactivated and becomes heterochromatic

• Transcription factors regulate gene expression: by binding to specific DNA sequences, either activating or repressing transcription, whereas silencers are DNA regions that decrease the rate of transcription by preventing activators and RNA polymerase from accessing the promoter

• Alternative RNA splicing: a process where a single gene can produce multiple different mRNA transcripts though selective inclusion or exclusion of exons, which increases efficiency by producing many different proteins from the same gene

• After mRNA is transported to the cytoplasm, gene expression can be regulated through several mechanisms, including mRNA stability, translation, and post-translational modifications of proteins