Manipulating Gene Expression – Key Vocabulary

Central Dogma of Biology

• Flow of genetic information:

  • DNA \rightarrow RNA (transcription) \rightarrow Protein (translation)

• Understanding this flow is essential to see where and how we can intervene to study or change gene function.

Linking Ideas & Key Question Framework

• When you believe gene X is important in process Y, always ask:

  • “Is gene X functionally relevant?”

  • “How can I prove or disprove that?”

• Two broad experimental strategies:

  1. Reduce/abolish expression (loss-of-function)

  2. Change the gene itself (mutation, insertion, deletion)

RNA Interference (RNAi) & Gene Silencing

Discovery & Recognition

• 2006 Nobel Prize (Physiology/Medicine) awarded to Andrew Z. Fire & Craig C. Mello.

• Citation: “for their discovery of RNA interference – gene silencing by double-stranded RNA”.

Mechanistic Overview

• Naturally occurring, post-transcriptional regulation mechanism.

• Key molecular players:

  • Dicer: RNase III enzyme that chops dsRNA into \sim21\,\text{nt} single-stranded fragments.

  • siRNA (small interfering RNA) – experimentally added; perfectly complementary to target mRNA.

  • miRNA (microRNA) – genome-encoded; often partially complementary.

  • RISC (RNA-Induced Silencing Complex) – incorporates guide strand and uses AGO2 endonuclease activity to cleave target mRNA.

  • TRBP – Dicer co-factor aiding miRNA processing.

• Consequence: mRNA degradation \Rightarrow no translation \Rightarrow ↓ protein level (functional knockdown).

Practical Use of siRNA

• Researchers can purchase predesigned or custom siRNA (e.g.
  horizon discovery ON-TARGETplus, Accell, siGENOME, Lincode).

• Vendors guarantee ≥75\% knock-down; chemically modified to reduce off-target effects.

• Delivery options: lipid transfection, electroporation, self-delivering chemistries, viral vectors.

Clinical Translation

• 2018 FDA approval of patisiran: first RNAi therapy (hereditary transthyretin amyloidosis).

• Ongoing pipeline addresses liver, ocular, and blood disorders (Setten et al., Nat Rev Drug Discov 2019).

Alternative/Complementary Silencing → CRISPR Systems

• Limitation of RNAi: works at mRNA level, usually transient, can have off-target suppression.

• Need tools that permanently alter DNA: enter CRISPR-Cas technologies.

CRISPR-Cas Gene Editing

Historical Landmarks

• 2012: Jinek et al., Science – programmable dual-RNA-guided DNA endonuclease (Cas9).

• 2013: Cho et al., Nat Biotechnol – first targeted genome engineering in human cells.

• 2020: Nobel Chemistry – Emmanuelle Charpentier & Jennifer A. Doudna “for the development of a method for genome editing”.

Glossary

• CRISPR – Clustered Regularly Interspaced Short Palindromic Repeats.

• Cas – CRISPR-associated protein (endonuclease).

• gRNA / sgRNA – (single) guide RNA directing Cas9 to matching DNA.

• PAM – Protospacer Adjacent Motif; short consensus (e.g. \text{NGG} for SpCas9) required downstream of the target.

• Endonuclease – enzyme that cleaves phosphodiester bonds within a nucleic-acid strand.

Why CRISPR-Cas Is Powerful

• Programmable: change 20-nt guide to retarget Cas9 anywhere with a PAM.

• RNA-guided: no need to re-engineer protein for each site.

• Multipurpose: gene knockout, knock-in, base editing, epigenetic modulation.

• Supported by vast online tools (Addgene, Broad Institute, Benchling) for guide design & off-target prediction.

Molecular Cut-and-Paste Mechanism

1. Cas9–gRNA complex scans DNA for PAM.

2. Upon PAM recognition, gRNA base-pairs with protospacer.

3. Cas9 introduces a double-strand break (DSB) \sim3\,\text{bp} upstream of PAM.

4. Cell repairs DSB via:

   • NHEJ (Non-Homologous End Joining):
     • Fast, template-free, error-prone (insertions/deletions).
     • Ideal for gene knockouts.

   • HDR (Homology-Directed Repair):
     • Uses homologous donor template.
     • Precise point mutations, small insertions (<10\,\text{bp}), or large cassettes (e.g. fluorescent tags).

Next-Generation Editors

• Base Editors (Komor et al., Nature 2016): fuse Cas9-nickase with cytidine/adenine deaminase → convert C\rightarrowT or A\rightarrowG without DSB.

• Prime Editors (Anzalone et al., Nature 2019): Cas9-nickase + reverse transcriptase + pegRNA → write any small edit (point, indel) without DSB.

• Advantages of “no-break” tools: reduced large deletions, chromosomal rearrangements, p53 activation, off-target DSB toxicity.

Ethical Milestones & Controversies

• 2017: Human embryo editing proof-of-concept (Ma et al., Nature).

• 2018: He Jiankui announces CRISPR twins; condemned for unethical germline editing → 3-year prison sentence (Dec 2019).

• 2023: Post-release proposal to edit embryos for Alzheimer’s protection (APP A673T) using base editing; highlights ongoing governance challenges.

Clinical Application Case Study – Sickle Cell Disease & β-Thalassemia

• Pathophysiology: Severe symptoms after fetal-to-adult hemoglobin switch.

• Modifier insight: SNPs in BCL11A lessen disease severity by permitting fetal hemoglobin (HbF) expression.

• Strategy (Frangoul et al., NEJM 2021):

  1. Harvest patient HSCs (CD34^+ cells) from bone marrow.

  2. CRISPR-Cas9 cuts erythroid enhancer of BCL11A via sgRNA targeting sequence …TAGTCTAGTGCAAGCTAACAG… adjacent to PAM.

  3. NHEJ disrupts enhancer → ↓ BCL11A → derepress HbF.

  4. Myeloablative conditioning; edited HSCs reinfused (ex vivo editing, NOT germline).

• Outcomes: Sustained HbF >30\%, transfusion independence (early trial data).

• Regulatory timeline:

  • Apr 2023: CRISPR Therapeutics/Vertex submit Exa-cel dossier.

  • Oct 31 2023: FDA advisory panel deems therapy “safe enough”.

  • Nov 16 2023: UK MHRA grants first national approval (Casgevy).

Limitations, Risks & Ethical Considerations

• Off-target edits, large deletions, chromothripsis.

• Germline vs somatic editing distinctions; potential inheritance of unintended changes.

• Equity of access, “designer babies”, enhancement vs therapy.

• Regulatory patchwork (FDA, EMA, China NHC) & need for global consensus.

• Ongoing public engagement via documentaries (Netflix “Unnatural Selection”), books (“A Crack in Creation”), podcasts (Radiolab CRISPR update).

Practical Resources

• Broad Institute CRISPR Timeline

• Addgene CRISPR Science Guide & gRNA design tool

• WIRED Guide to CRISPR (2019)

• “Heroes of CRISPR” (Cell, 2016) review article

Learning Objectives – Revisited

✓ Describe gene-function interrogation methods (RNAi, CRISPR variants).
✓ Explain CRISPR’s programmable, versatile nature & superior potential.
✓ Outline CRISPR-Cas9 mechanism: gRNA targeting, DSB, NHEJ/HDR repair.
✓ Discuss germline editing ethics, highlighting real cases & regulatory responses.

Ultimate Takeaways

• RNAi is powerful for transient, post-transcriptional knockdown; useful for functional screens.

• CRISPR-Cas revolutionized biology by allowing precise, permanent DNA edits; spawned derivative tools minimizing collateral damage.

• Clinical translation is already here (sickle cell, β-thalassemia) but poses profound ethical and societal questions, especially for germline interventions.

• Responsible innovation demands technical rigor and robust ethical oversight.