Bio 111

LECTURE 1 + 2

All groups of living organisms share:

  • order

    • organisms are highly organized structures that consist of one or more cells

  • sensitivity or response to stimuli

    • chemotaxis: process of tiny bacteria moving toward or away from chemicals

    • phototaxis: process of tiny bacteria moving toward or away from light

    • moving toward a stimulus = positive response (v.v.)

  • reproduction

    • single-celled organisms duplicate their dna to reproduce

    • multicellular organisms produce specialized reproductive cells 

  • adaptation *

    • consequence of evolution by natural selection 

    • enhance reproductive potential and ability to survive

    • eg. heat-resistant Archaea living in boiling hot springs

    • not constant

  • growth and development

    • according to specific instructions coded for by organisms’ genes

    • ensures youth will grow to exhibit many of the same characteristics as its parents

  • regulation / homeostasis

    • homeostasis (steady state): refers to the relatively stable internal environment required to maintain life

      • eg. digestive systems perform specific functions like removing wastes

    • able to maintain homeostatic internal conditions within a narrow range almost constantly (despite environmental changes) by activation of regulatory mechanisms

      • eg. thermoregulation: process of organisms regulating their body temp.

  • energy processing

    • some capture energy from the sun and convert it into chemical energy in food; others use chemical energy from molecules they take in

      • Energy is stored in living things in the form of chemical energy 

      • chemical energy: energy stored in the bonds between atoms of molecules

      • In plants and other photosynthetic organisms, light energy is used to put sugars tgt

    • Takes energy to make sure inside is diff from outside and all other properties of life

    • Law of conservation of energy: energy is converted from one form to another

  • evolution *

    • diversity of life is result of mutations / random changes in hereditary material over time

    • allow organisms to adapt to a changing environment -> greater reproductive success

NOTE: Viruses are not considered living

  • Have to invade and hijack a living cell

  • Need an appropriate host to reproduce

  • Neither grow nor use energy while outside host

  • Cannot maintain stable internal environment

  • Def biological but not considered alive

Levels of Organization of Living Things

  • atom (consists of a nucleus surrounded by electrons): smallest and most fundamental unit of matter that retains the properties of an element

  • molecule: a chemical structure consisting of at least two atoms held together by a chemical bond

    • Anabolic: small molecules + energy -> large ones

    • Catabolic: large molecules -> small ones + energy

  • macromolecules: large molecules that are typically formed by combining smaller units called monomers

    • eg. deoxyribonucleic acid (DNA): contains the instructions for the functioning of the organism

  • organelles: aggregates [collection of units or particles (eg. cells) forming a body or mass] of macromolecules surrounded by membranes contained in some cells

    • small structures that perform specialized functions

  • cell: smallest fundamental unit of structure and function in living organisms

    • maintain stable internal environments

    • single-celled or multicellular organisms

    • classified as prokaryotic (single-celled organisms that lack organelles surrounded by a membrane and do not have nuclei surrounded by nuclear membranes) or eukaryotic (have membrane-bound organelles and nuclei)

  • tissue: groups of similar cells carrying out same function made from combined cells in most multicellular organisms

  • organs: collections of tissues grouped together based on a common function

    • present in animals and plants

  • organ system: higher level of organization that consists of functionally related organs

    • eg. vertebrate animals (animals that have a backbone and a skeleton) have many organ systems such as circulatory system

  • organisms: individual living entities

    • single-celled prokaryotes and single-celled eukaryotes are considered organisms (typically referred to as microorganisms)

  • population: all the individuals of a species living within a specific area

  • community: set of populations inhabiting a particular area

  • ecosystem: consists of all the living things in a particular area together with the abiotic [non-living] parts of that environment such as nitrogen in the soil or rainwater

  • biosphere: collection of all ecosystems

    • Energy used to sustain the biosphere comes from the sun

NOTE: atom -> molecule -> organelles -> cells -> tissue -> organs and organ systems -> organisms, populations, and communities -> ecosystem -> biosphere

Cell Theory

* Schleiden and Schwann used microscopes to establish the “cell theory”

  1. all organisms are composed of one or more cells

  2. cells are the basic structural and functional unit of all living organisms

  3. cells only arise from pre-existing cells

    THE PROCESS OF SCIENCE

    1. scientific method: method of research with defined steps that include experiments and careful observation

    • testing of hypotheses

    1. hypothesis: testable, falsifiable statements that attempt to explain an observation/ phenomenon

    • can never be proven

    1. theory: when there is overwhelming evidence supporting a hypothesis

    • Strongly supported explanations


inductive reasoning: form of logical thinking that uses related observations to arrive at a general conclusion

  • involves formulating generalizations inferred from careful observation and the analysis of a large amount of data

deductive reasoning: form of logical thinking that uses a general principle or law to predict specific results

  • eg. if the climate is becoming warmer in a region, the distribution of plants and animals should change

descriptive (or discovery) science: aims to observe, explore, and discover

hypothesis-based science: begins with a specific question or problem and a potential answer or solution that can be tested

Each experiment will have:

  • variable: any part of the experiment that can vary or change during the experiment

  • control: part of the experiment that does not change

NOTE: make an observation -> ask a question -> form a hypothesis that answers the question -> make a prediction based on the hypothesis -> do an experiment to test the prediction -> analyze the results -> hypothesis is supported -> report results

If hypothesis is not supported -> new hypothesis can be proposed

Living things use and process energy:

  • Autotrophs: make use of non-biological (abiotic) sources of energy (eg. light) to produce complex molecules

    • These molecules store energy to be used for other processes in the organism

  • Heterotrophs: must use complex molecules produced by autotrophs as energy source

    • Eg. humans

PRODUCERS: plants

CONSUMERS: animals

DECOMPOSERS: fungi, bacteria, worms

LECTURE 3 + 4

Building blocks of life:

  • Biologically relevant chemicals have specific properties that depend on the elements they contain and their arrangement

    • Most commonly found elements: carbon, oxygen, nitrogen, hydrogen, phosphorus

    • Usually molecules that consist of covalently-bonded atoms in specific arrangement (determines shape which determines function)

  • Covalent bonds: electrons are shared between atoms to form strong association

    • Polar covalent bonds: when electrons are not shared equally between atoms

  • Hydrogen bonds: a weak bond between hydrogen and strongly electronegative elements (eg. oxygen, nitrogen and fluorine)

    • slight positive charge for hydrogen and slight negative charge for other atom

    • Many hydrogen bonds between water atoms result in its unique properties

Carbon

  • carbon atoms form the fundamental components of most of the molecules found uniquely in living things

    • qualify as the “foundation” element for molecules in living things cuz of the bonding properties (capable of bonding w up to 4 other atoms)

  • Carbon-containing compounds are sometimes called organic compounds

    • Organic molecules contain carbon bonded to other carbons or hydrogen

    • Simplest organic carbon molecule is methane (CH4)

    • Carbon monoxide, carbon dioxide = usually considered inorganic

      • Takes a lot of energy to break their bonds and turn them into smth biologically relevant

      • Conversion from inorganic carbon to organic molecules is called carbon fixation (crucial step of earth’s carbon cycle

        • Performed by autotrophs 

We can classify most biologically relevant chemicals into 4 major types:

Lipids:

  • Long chains of carbon and hydrogen

  • Important energy source

  • Can sometimes form rings (as in sterols)

    • Eg. cholesterol, testosterone

  • Hydrophobic (do not interact well w water):

    • Chains of carbon and hydrogen are neutral in charge (do not form polar covalent bond; electrons are equally shared)

    • Only small part of these molecules can interact w water 

  • Lipids placed in water will arrange themselves to “shield” hydrophobic portions away from water

    • Will form little spheres called micelle (circular parts = polar heads that can interact w water; hydrophobic parts are trapped inside)


  • Long-chain lipids can be saturated or unsaturated

    • Unsaturated fatty acids are often liquid at room temp.

    • C = trans-fat molecule

      • Even tho unsaturated, can be packed more tightly -> can end up solid at biologically relevant temp


Phospholipids: really important to life

  • Phospholipid bilayer: assembly of phospholipids in water when the tails are facing inwards towards each other and the heads are pointing outwards towards the water molecules

    • Forms the basis of a biological membrane




Carbohydrates:

  • Have lots of oxygen in structures

  • Hydrophilic (can interact w water)

  • Most carbohydrates will convert into rings

  • Major carbohydrates have 6 carbon atoms:

    • Monosaccharides (simple sugars eg. glucose): primary energy-rich compounds broken down to produce energy

    • Disaccharides: formed when two monosaccharides come tgt

      • Eg. glucose + fructose -> sucrose (table sugar)

      • Eg. glucose + glucose -> maltose (malt sugar)

      • Eg. galactose + glucose -> lactose

    • oligo/polysaccharides: longer chains that serve storage or structural purposes

      • starch: stored form of sugars in plants

      • glycogen: storage form of glucose in animals

        • Has branches

      • cellulose: found in plant cell walls

        • Chains of glucose put tgt 

        • Eg. found in wood, paper, cotton

      • chitin: consists of slightly modified carbohydrates

        • Animal and fungi specific 


Nucleic acids:

  • Structure on right is a nucleotide

  • Nucleotide monomers polymerize to form nucleic acids

  • Nucleic acids primary store genetic info in cells

  • Base: determines identity of nucleotide

    • Nucleoside: the ribose sugar + base

    • Nucleotide: sugar + base + 1 to 3 phosphates

  • 2 types of nucleic acids: DNA + RNA

    • RNA: uses ribose

    • DNA: uses deoxyribose

    • Slight difference where RNA has hydroxyl (OH) and DNA has hydrogen (H)

    • RNA uses uracil while DNA uses thymine


  • 5 kinds of nucleotides

    • Each type of nucleic acid only contains 4 of the 5

      • Cytosine, Thymine, Guanine, Adenine, Uracil

    • Base pairing:

      • Each nucleotide specifically pairs w another

      • A pairs w T (or U in RNA)

        • Held tgt by 2 hydrogen bonds

      • G pairs w C

        • Held tgt by 3 hydrogen bonds; stronger bond

  • Nucleotides on their own can also be:

    • Temp. high-energy molecules in cells

    • Signaling molecules

  • Nucleotides as energy “currency”:

    • Energy from breaking down sugars and lipids are usually not directly used for a cell function that needs it

      • Energy is stored in individual nucleotides (ATP or GTP) taht can be used universally throughout the cell in a variety of functions

        • These nucleotides are like energy currency (cell’s supply of money) supplying energy to whatever cellular function needs it

        • Adenosine triphosphate (ATP): 

          • Has extra phosphates

          • Transfers energy from broken down sugars and fats to various cellular functions

          • Energy from breaking down sugars and lipids fuel ATP production

        • GTP would have diff nitrogenous base


  • Chains of nucleotides have directionality:

    • The end of nucleotide w phosphate is 5’ (5 prime)

    • End w hydroxyl is called 3’ (3 prime)

      • New nucleotides are added at 3’ end

  • One chain or “strand” interacts w its complementary strand

    • Runs in opposite direction; strands are antiparallel

  • Covalent bonds hold the nucleotides of a single strand tgt

    • Makes strong ladder

  • Hydrogen bonds are between the bases

    • Allows DNA to function in some way

  • Sequence of diff nucleotides encodes info:

    • Like letters that make words

    • Order in which the nucleotides are joined tgt into nucleic acids is v important

      • Eg. ATCG is not the same as CAGT

  • Complementary Sequence:

    • 5’ - GCACGGAGACCAAGACTTAATGTGGTGGGA - 3’ would be 

    • 3’ - CGTGCCTCTGGTTCTGAATTACACCACCCT - 5’

  • RNA structure:

    • Single-stranded RNAs can fold in diff, characteristic ways

      • Can interact w itself to form elaborate structures

      • Can form specific structures that perform specific functions

    • The sequence of nucleotides determines an RNA molecule’s structure

      • It determines its position within the molecule overall, and this influences which nucleotides can interact w each other

Proteins:

  • Do all sorts of things in the cell (most diverse in function)

  • Polymers of various amino acids

  • Each amino acid monomer has unique “side chain”

  • “20” kinds of amino acids relevant to life

  • All living things and viruses contain proteins

  • Examples of proteins: enzymes, gluten, lactose, etc.

  • Amino acids: the fundamental units (monomers) that make up proteins - at least 20 diff ones

    • Covalent bonds hold the amino acids of a protein tgt

  • Peptides: short(ish) chains of amino acids (less than 30 amino acids)

  • Proteins: long(ish) chains of amino acids (more than 30)

  • Proteins can be defined by their amino acid sequence

    • Just like nucleic acids



  • Enzymes: 

    • Essential chemical reactions occur far too slowly to sustain life if unaided

    • Enzymes speed up (or make possible) reactions in the cell

      • Catalysts: catalyze biological reactions (speeds up a chemical reaction)

  • Proteins folding:

    • Proteins fold into specific structures or conformations

      • Diff parts of amino acid chain can interact w each other to make this happen

    • Shape of a protein is crucial for its function

      • Determined by amino acid sequence

    • Enzymes need to be in specific shapes to help speed up chemical reactions essential for life

Polymerization and biopolymers

  • Pattern of repeating subunits being chained tgt into larger molecules

LECTURE 5

Cells

  • 2 very distinct kinds of cells on earth

  • Makes one domain of life distinct from the others

    • Domains are one level higher than kingdoms in the hierarchical categorization of life

  • 3 domains of life:

  • Think of domains as branches of a tree

    • Bacteria (prokaryotic)

    • Archaea (prokaryotic)

    • Eukarya (or eukaryota or eukaryotes)

Biological membranes

  • All life makes use of biological membranes

  • Very important in separating outside world from the inside (plasma membrane)

  • All biological membranes are selectively permeable

    • Things still need to get across membranes

  • Semi-permeable, selective barriers

  • Mostly made of phospholipids and proteins w highly specialized functions

  • Considered a “fluid mosaic”

    • Mosaic of a variety of diff components

    • Fluid cuz things can slide around the membrane



  • Cholesterol helps fill in gaps within cell membranes to help keep it tgt

  • Proteins: 

    • All sorts of things

    • Can make channels to allow materials to enter and exit the cell

    • Enzymes to speed up reactions near the membrane

    • Receptors to respond to stimuli

    • Attachment points for structural components

  • Carbohydrates: 

    • Only on plasma membrane and only facing outside of the cell

    • Identifies the cell to its neighbours (like a nametag)

    • Other more specialized functions

What substances need to enter and exit cells?

  • Eg. O2, CO2, Glucose, Sodium, Potassium, H2O

Crossing the membrane (passive transport)

  • Passive transport does not require energy input

    • Larger substances may still require a protein to serve as a channel or pore as a pathway through the membrane

  • Movement is w a concentration gradient (when one side of the membrane is more concentrated than the other)

  • Diffusion: dissolved materials moving from areas of higher concentration to lower concentration

    • Spread thru and equalize concentration on both sides

  • Osmosis: water moving from an area of lower solute concentration to higher solute concentration

Crossing the membrane (active transport)

  • For substances either too big or has an electrical charge so it cannot just pass through the plasma membrane

  • When moving things against a concentration gradient

  • Transport protein must consume energy to move that substance across the membrane

NOTE: plant cells have cell wall so they cannot perform phagocytosis; bacteria have capsules so they cannot perform phagocytosis either

Exocytosis

  • Essentially the reverse of endocytosis

  • Vesicles fuse w the plasma membrane and release (secrete) its contents



LECTURE 6

What’s inside a prokaryotic cell?

Prokaryotes vs Eukaryotes

  • Eukaryotic cells are:

    • more complex than prokaryotic cells

    • Major defining intracellular structure of eukaryotes: nucleus

    • Generally larger

    • The cytoplasm of eukaryotic cells is further divided into compartments (organelles)

Organelles

  • What organs are to a human

  • Eukaryotes especially have a large variety of organelles within their cells

    • Further compartmentalize diff functions (divide into sections or categories)

    • The endomembrane system is an expansive network of internal membranes that process proteins

Cytoskeleton

  • prokaryotes have cytoskeletal proteins too but eukaryotes have a more elaborate network of these components that comprise the cytoskeleton

  • Major functions:

    • Structural and mechanical support for the cell

    • Regulates placement and movement of organelles

    • Allows the entire cell to move



Endomembrane system


Nucleus

  • The endomembrane system’s membranes connect w the nuclear envelope, which surrounds the nucleus

  • Major functions:

    • Storage of genetic info

    • Location where gene expression begins

    • Ribosomal subunits are assembled here

NOTE: it is false that cells can only have one nucleus; red blood cells have 0 and human skeletal muscle has 100+

Endoplasmic reticulum

  • Moving outwards from the nuclear envelope, the membranes of the ER form an extensive network that reaches the edges of the cell

  • Major functions:

    • Materials circulate within this network

    • Protein production / modification (RER)

    • Lipid synthesis (mostly SER)

    • Synthesis of other biological molecules

  • RER is rough because its surface is covered w ribosomes, which make it look jagged compared to the SER

Golgi apparatus:

  • “Stacks of pancakes”

  • Golgi is capitalized cuz named after someone

  • Major functions:

    • “Sorting center” of the cells

      • Materials could be leaving the cell

      • Or to the lysosome

Lysosome

  • Acidic and violent

  • Lysosomes digest ingested or worn-out substances to recycle the components

  • Major functions:

    • Enzymes inside digest biological molecules

    • Digests ingested prey

    • Breaks down cellular components

Vesicles and vacuoles

  • Various other membrane-bound compartments move around the cell, such as vesicles and vacuoles

  • Major functions:

    • Movement of substances from one part of the cell to another

      • Or to the plasma membrane

    • Areas where substances are stored

    • “Vesicle” reserved for smaller structures, “vacuole” for larger

Mitochondria

  • Forever the “powerhouse of the cell”, the double-membraned mitochondria supply the cell w lots of high-energy ATP

  • Major functions:

    • ATP production through oxidation of products from the breakdown of glucose and lipids

      • ATP exported from mitochondria into the cytoplasm

    • Production of specialized compounds

Chloroplasts

  • Using the sun, the double-membraned chloroplasts generate lots of ATP for itself to make organic carbon

  • Major functions:

    • Photosynthesis

    • ATP production via light energy

      • ATP remains within chloroplast

    • ATP used to produce pieces of carbohydrates

    • Production of specialized compounds (like mitochondria)

Carbon fixation and photosynthesis

NOTE: Q: In which type of organisms did photosynthesis first appear on Earth? 

A: Bacteria

Q: which of the following is a waste product of photosynthesis?

A: Oxygen 

Endosymbiotic theory

  • The cytoskeleton and endocytosis allowed for the acquisition of 2 v important eukaryotic organelles, mitochondria and plastids (of which chloroplasts is one type)

  • Mitochondria and chloroplasts descended from this undigested food (bacteria getting ingested by eukaryote and escaping into cytoplasm)

    • They look like and divide like bacteria

    • Divide “independently” of its host cell

  • Establishment of mitochondria and chloroplasts opened up new lifestyles for eukaryotes and brought photosynthesis into this domain

NOTE: mitochondria appeared first in eukaryotes because all eukaryotes have them

LECTURE 7

NOTE: which of the following statements are false regarding genes?

A: genes consist of all the DNA in a cell or organism 

-> refers to a genome not gene
Genomes

  • Adult humans are comprised of ~100 trillion cells, each differentiated to perform diff functions

  • Differentiated cells in a multicellular organism have the same genome w diff subset of genes expressed in each

Answer: A 


  • Chromosomes may be complexed w proteins that help make it more compact 

    • We call this complex of DNA and protein chromatin

  • Humans have 23 pairs of chromosomes

    • In most of our cell’s nuclei, there are 46 pieces of (double-stranded) DNA

  • Most chromosome pairs are homologous

    • Meaning a chromosome is mostly identical in nucleotide sequence to its homologous pair

    • For each chromosome pair, barring natural variation, we should have at least 2 copies of any given gene in similar areas of each chromosome

    • One pair of chomoromes are sex chromosomes

      • Individuals that have two X chromosomes -> homologous

      • Individuals w one X and one Y -> not homologous

    • One copy of each chromosome’s sequence is represented in the human genome

NOTE: approximately 3 billion base pairs comprise the human nuclear genome

  • Most of the human genome is identical between individuals

    • There is variation

  • Reference human genome is an average of all these variations and does not represent one particular person


  • DNA can be coiled and uncoiled as needed such that our cells can access the genetic info within


LECTURE 8

DNA replication

  • Before cells divide, their genome needs to be faithfully replicated so that one copy can be passed into each of the progeny cells (offspring)




NOTE: humans have approximately 20 000 genes 

Central dogma of molecular biology

  • Not rly a dogma but it links tgt DNA, RNA, and proteins, as well as the flow of genetic info in all life

  • Eg. DNA: the genome = the cookbook

  • RNA: copy of a part of the genome = individual recipe copied out

  • Protein = the product


NOTE: the biological molecule where genes are located is DNA

  • Promoters are regions where RNA polymerases bind before initiating transcription

  • Terminators are regions where RNA polymerases detach to end transcription

Genes have directionality on the genome

  • The promoter is usually “upstream” of the functional sequence, while the terminator is “downstream

 

Transcript functions

  • Eukaryotic mRNA usually represents a single gene and codes for a single product

  • Prokaryotic mRNA carries a series of functionally-related genes (an “operon”) that code for multiple products

  • rRNA and tRNA do not have coding sequence


  • Eukaryotic mRNA coding sequences are interrupted by non-coding sequences called introns

  • Pieces of coding sequence are called exons, and the coding sequence usually begins and ends w an exon

  • All happens in nucleus and requires special enzymes called spliceosomes (RNA and protein)

LECTURE 9

3 major types of RNA in all cells: 

  • Messenger RNA, ribosomal RNA, transfer RNA

  • RNA is inherently unstable, all kinds are turned over relatively frequently

  • constantly making RNA all the time to make sure we have an ample supply 

    • Every function in cell requires some sort of protein to mediate it

Translation

  • RNA -> protein

  • Process where mRNA are translated into functional proteins

  • Sequence info represented in the mRNA transcript is now “decoded” to represent any possible amino acid

Protein

  • By convention, amino acids are written left to right from N-terminus (amino) to C-terminus (carboxy)

    • Eg. Lys-Gly-Asp-Glu-Glu or KGDEE

NOTE: Four diff nucleotides in RNA and twenty-ish diff amino acids found in proteins

  • Q: at least how many nucleotides are required to represent any one particular amino acid?

  • A: need three for 20 diff amino acids

    • Possible combos of one nucleotide: 4 (ATCG)

    • “ two nucleotides: 16


Q: which is true regarding mRNA?

A: mature mRNA lacks introns

NOTE: mRNA does not contain Ts

mRNA and translation

  • mRNA acts as template for chaining tgt amino acids in specific sequence

  • Info within coding sequence are divided into codons (“words” made of 3 nucleotides each)

    • Eg. AUG CCG AAA

Ribosomes, rRNA and translation

  • Ribosomes are protein synthesis machines:

    • Made of proteins and rRNAs

    • rRNA acts like an enzyme

    • Physically links amino acids tgt

    • Two components: small and large subunit

    • Large subunit contains binding sites for tRNAs

tRNA and translation

  • RNA molecules that carry amino acids to the ribosome

  • tRNAs fold to form a specific structure

  • tRNAs have specific anticodons and hold specific amino acids

    • Anticodon: a 3 nucleotide sequence on a tRNA molecule that base pairs w the codons in an mRNA

      • Pay attention to directionality of codon and anticodon!

  • Each amino acid corresponds w a specific codon via its anticodon

Translation

  1. Initiation

    1. Translation initiation in eukaryotes starts w tRNA and small ribosomal subunit recruitment by initiation factors at the 5’ cap

    2. Once the start codon (AUG) is detected, the large ribosome unit attaches w the first tRNA in the P (peptidyl) site

  2. Elongation

    1. Second tRNA enters the ribosome at the A (aminoacyl) site and the first bond that is made links the C-terminus of methionine (Met) to the N-terminus of the next amino acid (eg. valine or Val)

    2. The entire complex moves towards the 3’ end of the mRNA by exactly 1 codon

      1. Codons do not overlap !!

      2. The first tRNA moves into the E (exit) site and is ejected

      3. The second tRNA moves into the P site, and the next tRNA enters the A site (and the process repeats)


Translation and reading frames

  • Consequence of having the code in sets of 3 bases is that there exists 3 possible reading frames

    • Each of these reading frames would produce a diff protein

    • The ribosome uses the reading frame established by the start codon

    • Critical for correct protein synthesis 

    • Frameshift: when u shift reading frame by just adding a letter to the beginning (eg. THEBIGBOY -> XTH EBI GBO)

  1. Termination

  • Stop codon is reached eventually (UGA, UAA, UAG); stops protein synthesis

  • Amino acid chain gets cut off the tRNA in P site and everything disassembles


The universal genetic code

  • Summarizes all 64 possible codons and their meaning in protein synthesis

  • All 3 domains of life, plus viruses, use the universal genetic code

    • Provides strong evidence life arose (evolved) just once

NOTE: reverse translation does not take place, one direction flow from RNA to protein

  • Can’t go backwards from amino acid sequence to nucleotides because there are eg. 4 diff codons for glycine (not sure which codon cuz more than one codon can code for the same amino acid -> why genetic code is termed “degenerate” or “redundant”)


  • Met is the first amino acid for every single protein

NOTE: table of codons = written 5’ to 3’ and represent triplets in mRNA

Q: What is the anticodon on the tRNA for tryptophan (Trp / UGG)?

A: 3’ ACC 5’


Examples of translation:

5’ CCCAUGAUCCAACCGUAUUAAAGC 3’ ->

Met - Ile - Gln - Pro - Tyr

LECTURE 10

Recombinant DNA

  • Techniques to move DNA species from one to another

  • Combined DNA from different sources

  • Usually short stretches

    • Since most living things have mechanisms to keep foreign DNA out

Insulin

  • Protein hormone that tells cells to start taking up glucose in the blood

  • When there is blood in glucose, it induces the production of insulin / start release of insulin

  • Human insulin begins as a peptide with 110 amino acids

  • Called preproinsulin 

    • Proteins get processed as it matures into its final form

How long must the coding region (start to stop codon) be?

  • 110 nucleotides

  • 327 nucleotides

  • 330 nucleotides

  • 333 nucleotides

    • It's 333 because 330 accounts for the 110 amino acids (110*3 nucleotides in each amino acid= 330) + the extra 3 nucleotides for the stop codon

After processing, insulin consists of 51 amino acids

Cells can be starved from glucose because the insulin is not at a sufficient level or body doesn't respond to it properly

  • Results in diabetes

  • Type 1 gets injections of insulin

1921 in UofT, Sir Frederick Banting and colleagues have successfully isolated insulin from animal pancreases

  • He was one of the recipients of the nobel prize for this process

  • Crucial for allowing people with diabetes to be not starved of glucose

What can we infer about insulin from other animals?

  • Maybe we can’t differentiate animal and human insulin

  • Animal insulin is the same as human insulin 

    • Similar enough to human insulin

  • In terms of molecular standpoint, the amino acid sequences of human and animal should be quite similar

    • Human and pig insulin = one amino acid that’s different

Order of the amino acids matter because it causes the protein to have a specific shape

  • Without the shape it's not going to function, it's not gonna fold

Insulin was the first protein to be sequenced

  • Done by Frederick Sanger

  • It was the primary way to be able to determine nucleic acid sequences for almost 40 years

NOTE: Glucose region is for humans to determine whether or not we need to produce insulin

  • We need at least a promoter so RNA polymerase can start doing its thing

Plasmids and bacteria

  • bacteria often naturally contain small circles of DNA called plasmids

    • Often contain a few genes and can spread thru a population of bacteria

Molecular cloning

  • cloning = making an exact copy

  • Can clone genes like insulin

    • By using restriction enzymes to precisely cut and insert gene into a plasmid -> bacteria will make copies when they replicate their DNA

    • Must also include sequences that promote transcription (promoter) if we want to express the gene


Restriction enzymes:

  • Naturally found in bacteria as defense against foreign DNA

  • Cuts at specific sequences

  • Some make staggered cuts at its specific sequence -> leaves an overhanging region of nucleotides

    • If our gene of interest is engineered to include a matching overhang, they can base pair


  • Making pieces of our gene of interest at large enough quantities to clone into plasmids used to be very challenging

    • Was solved w PCR

Polymerase chain reaction (PCR):

  • Commonly used technique to make lots of copies of a specific region of DNA

  • Not just for molecular cloning but also for genotyping, sequencing, diagnostic tests (for detecting SARS-CoV-2 and all sorts of other pathogens)

  • Polymerase = makes use of DNA Pol

  • Chain reaction = the more rounds of reactions are performed, the more copies are made

  • DNA Pol cannot actually start replicating DNA from anywhere -> needs a primer to provide a 3’ end to add nucleotides

    • We can design specific primers that border the gene of interest

      • DNA Pol comes in and makes copies only from the locations we specified (becuz process is exponential - new copies become templates for later replication - can makes lots of copies of gene of interest quickly)


LECTURE 11

  • Midterm review

LECTURE 13

How do we grow up?

  • Increase in number of cells

  • Cells divide and get larger

  • Mostly dividing 

  • Little different for plants

Cell cycle 

  • summarize / concisely how cells progress through their life up until division(reproduction)

2 broad parts of cell cycle

  • Interphase

    • G1, S, G2 phases

  • Mitosis and cytokinesis 

    • M phase or miotic phase

Interphase

  • Majority of a cell’s life cycle

  • Carry out their cellular function in this phase

Major Cellular processes in Interphase

  • General growth

  • Replication of chromosomes

  • Preparation for cell division

End goal for living things is to reproduce

  • Make like copies of themselves

The G stands for gap in G1/G2 phase

  • Because it looks like nothing really goes on

    • Gap in its life cycle

  • Very far from reality bc many things are happening

    • Gathering up or synthesizing resources for growth

    • General cell growth

    • Growth/replication of organelles

What is different between G1 and G2 phases?

  • Cells in G1 have half as much dna in G2

  • Because the replication process is in between

S stands for synthesis

  • This is where the dna synthesis happens

  • New dna is synthesized

  • You need to make sure the daughter cell has the instructions needed to make the proteins for its daily life

  • All of a cells chromosomes are replicated in preparation for division

Chromosomes replicate during S phase

  • Replicated chromosomes still attach at the centromere

    • Centromeres are important structures for mitosis

    • While attached, they're still considered as ONE chromosome

  • Forms the “X” Shape

  • Each half is called sister chromatid

    • Each “line” of the X is considered as” half”

  • Sister chromatids will them separate into each of the daughter cells

Before S phase begins how many total chromosomes are there in a typical human cell

  • There are 46 total chromosomes before S phase 

  • There are 23 PAIRS of chromosomes

    • They're homologous pairs

      • Homologous means having the same structure and pattern of genes

      • Important for meiosis

After S phase

  • Also 46 because they count as one even with two sister chromatids

After S phase there are 92 total sister chromatids

These numbers are relevant for human cells 

  • Because humans have 23 pairs of chromosomes

  • Different organisms have different numbers of chromosome

Chromosomes have nothing to do with the complexity of the organism

Cell cycle is carefully controlled at CHECKPOINTS

  • At the end of G1 and G2 phases

  • Controlled by the presence and absence of numerous proteins and their activity

Why are checkpoints important ?

  • To make sure they are ready to divide (important)

    • Are there enough resources in the environment

      • It's not good for cell 

    • Are any of its components damaged

      • Esp the DNA

    • Are its neighbouring cells signalling for/against division

      • In the context of multicellular organism

      • Signals from different part of the body or nearby cells will provide stimuli if it should or shouldn't 

G1 CheckPoint

  • Main Decision point

  • Once passed this point, a cell is irreversibly committed to dividing

  • Has to finish all this stuff and split into two

Cell checks internal and external conditions

  • Size : is the cell large enough to divide?

  • Nutrients : Does the cell have enough energy or available nutrients to divide?

  • Molecular Signals : is the cell receiving positive cues (such as growth factors) from neighbours

  • DNA Integrity : is any of the DNA damaged

Cells may also be cued to LEAVE THE CELL CYCLE and stop dividing

  • More relevant to multicellular organisms where not all the cells need to divide

Reasons of the stop

  • Not enough nutrients, neighbouring cells signal against division, etc

  • Cell doesn't need to divide

  • Enters a resting state called G0

    • It goes through the day to day life without ever processing though the rest of the cell cycle

  • May be permanent or temporary

    • Once conditions change or cell type is required to divide again, they reenter the cell cycle and go back into G1

G2 Checkpoint

  • Final check of the genetic material before chromosomes are separated into two different cells

  • DNA integrity : Is any of the DNA damaged?

    • During cell replication or other reasons

  • DNA replication : is the DNA replication complete

If DNA Damage is detected, cells will pause in G2 phase to repair

If unrepairable, cells will go through programmed death (Apoptosis) in multicellular organisms  

Why is apoptosis (programmed cell death) important

  • Could be a waste of energy

  • Not continuing this damage to further generations

  • Damage can alter the function

    • Changes in the proteins function

P53

  • Central to DNA Damage repair pathways is the protein p53, sometimes called the “guardian of the genome”

  • Damaged DNA will cause proteins to be activated that activates p53 to stop cell cycle

    • Damaged DNA causes p53 to activate genes that pause progress through the cell cycle

If p53 is mutated such that it doesn't function anymore, what happens when dna is damaged in a cell

  • The cell progress through the cell cycle and divides anyway

  • Even though the damage may occur, it's small compared to the entire gene

    • DNA damages is usually isolated to just a single nucleotide or a few

Very important for p53 to be intact do that it can pause the cell and allow DNA damage to be repaired

Having a loss of the control of the cell cycle and allowing cells to divide any way is definitely related to things like cancer

Genes involved in the cell cycle, when they are mutated in some way, they often result in uncontrolled cell division

  • AKA cancer

Uncontrollable cell division-> growth of tumours-> cancer

Genes associated with cancers include proto-oncogenes and tumour suppressor genes. Are the primary cellular functions of these genes to determine whether or not cancer occurs?

  • No 

  • It usually when these genes are not functional anymore, then we end up with a disease state(such as cancer)




Proto-oncogenes

  • Onco means cancer

  • Normal function is to promote the cell to divide into, allow it to divide

  • They're constantly encouraging the cell to progress through the cycle even if it's not supposed to go through

  • Only takes one mutated form

    • The one that is mutated is going to keep pushing the cell through the cell cycle

Tumour suppressor gene

  • Normal function is to stop cells from growing

  • EG p53

    • Pauses cell cycle so it can repair DNA damage

  • 1st mutation: second copy provides enough function

  • 2nd mutation : loss of function of cell cycle regulation and DNA repair

    • You don't have the prevention of stopping a cell to progress through its cell cycle 

    • It keeps progression into the cycle and continue more division


Is it possible to be born with these mutations?

  • Yes, because the second copy can still carry out the function for tumour suppressor 

  • For oncogenes, less likely for that to happen since it only takes one for uncontrollable cell division

Amoeba sister

Mitosis

  • Type of cell division done by most of your body cells to produce identical body cells

  • Important for cells to divide

  • If they didn't divide you wouldn't have grown

  • Make more cells to repair damage

Mitosis is not a process that makes sperm or egg cells

  • That meiosis

Mitosis is a very short time

  • If interphase was 90%, Mitosis takes 10% of the cell cycle

Chromosomes are made of DNA and protein

Acronym for the stages of mitosis - PMAT

  • P: prophase

    • Beginning step

    • Nucleus is visible

    • Chromosomes are condensing: they're thickening and visible 

  • M: Metaphase

    • M for middle

    • Nucleus is disassembled 

    • Chromosomes line up at the middle of the cell

  • A: Anaphase

    • A for Away

    • Chromosomes moving to opposite sides of the cells

      • Poles of the cells

    • Move with spindles

  • T: telophase

    • Chromosomes at the opposite ends and new nuclei is forming

Cytokinesis -AFTER PMAT

  • They split into two by the cytoplasm

When a cell starts with 10 chromosomes it ends with 10 and with 2 cells

LECTURE 14

Cell Cycle - in terms of single celled (unicellular) organisms

Unicellular Organisms

  • Unicellular is not the same as prokaryotic

  • Many species of organisms exist only as single cells

  • Prokaryotes are organisms whose cells DO NOT contain nuclei

Unicellular will progress through the cell cycle like cells in our own bodies

  • They grow and develop during G1 phase

  • DNA replication during S phase

  • G2 phase more more growth

  • Their nuclei will divide through mitosis and cytokinesis divides the cytoplasm to produce two cells 

Are unicellular organisms also controlled through checkpoints?

  • Yes

What might be different when thinking about checkpoints in unicellular organisms?

Why are checkpoints important?

  • Important that the cell is ready to divide

    • Enough resources?

    • Any components damaged?

    • Neighboring cells for/against division?

      • In unicellular organism, in terms of bacteria your neighbors may prevent you from dividing

      • In unicellular organisms eukaryotes, doesn't really appear for this thing

        • Considers more of what is in the environment

Which phase of cell cycle is most likely to differ in prokaryotes?

  • M phase

  • Mitosis doesn't take place in prokaryotes because they don't have a nucleus

Prokaryotes progress through their cell cycle a lot quicker

  • There is no mitosis because no nuclei (and multiple chromosomes) to divide or separate

In single celled organisms, cell division IS reproduction

  • True

  • Because now you have new individuals that are similar/the same as the parent

Reproduction

  • Living things reproduce

  • Means new organisms that are similar to their parent are produced

Two types of reproduction

  • Asexual

  • Sexual

When two individuals are clones, they are?

  • Genetically identical to each other

  • Think about it as twins

    • They are not exactly the same in appearance, form, or function.

      • There are some variation

Clonal organisms are genetically identical

Asexual reproduction results in clones or clonal individuals or clonal offspring

  • Key Idea : asexual reproduction results in new individuals that are clones of each other

  • In other words, offspring are genetically identical

  • Example includes :  parts of an animal may regrow new ones, like starfish

    • Usually accidental, not a way that things reproduce on a regular basis

Many familiar plants can reproduce asexually

  • New individual form through some part of the parent plant

    • Like green onions and garlic

Advantages of asexual reproduction

  • Only one individual is needed

  • Faster

  • If parent is well adapted, offsprings are immediately well adapted

Disadvantages of asexual reproduction

  • No genetic diversity

    • If there were mutation in parents, it would we propagated to offspring too

  • Easier spread of disease because of the lack of genetic diversity

Sexual Reproduction

  • Results in offspring whose genetic material is a combination of its parents 

    • Key idea : results in new individuals that are not genetically identical to its parents

  • Offspring should still be the same species as it's parents

    • Same number of chromosomes as its parents

So how can two parents with same number of chromosomes form a new individual with the same number or chromosomes

  • Somewhere in this process, cells with a different number of chromosomes must exist

Most multicellular eukaryotes reproduce sexually

  • May unicellular eukaryotes can reproduce sexually too

Advantages to sexual reproduction

  • Some part of the population can handle large environmental changes

    • That's why genetic diversity is important

Sexual reproduction in multicellular eukaryotes

  • Thinking of sexual reproduction at the organismal level

  • Not all cell are involved in reproduction

    • Somatic cells: sometimes vaguely called “body cells”, these comprise most of our body and are not involved in reproduction

      • Blood, bones, muscle, skin

    • Germ cells: these cells are responsible for producing gametes, the cells involved in sexual reproduction

      • In animals, they are “set aside” early in development - somatic cells don't suddenly become germ cells

A cell in your stomach (which is muscle tissue) gains a mutation. Does this pass to your offspring?

  • Stomach cells are somatic cell so no. they are not involved in reproduction

Gametes

  • Cells involved in sexual reproduction

  • Usually do not have the same number of chromosomes as the rest of the organism

    • Sperm and egg cells do not have same number of chromosomes as somatic cells

  • Fusion of gametes (fertilization) results in a new individual

  • Frequently in organisms that undergo sexual reproduction, gametes are differently sized

    • Female gametes

      • In terms of size, they are much larger

      • Often fewer in number

    • Male gametes 

      • Much smaller

      • Often more numerous

  • Organisms that have gametes who are similarly in size, we do not use these terms

Germ Cell vs Gametes

  • Germ cell undergo process that cut the amount of chromosomes in half, and that’s what produces the gametes

Sexual reproduction in plants

  • In flowering plants, flowers are the sexual reproduction organs

    • They have male and female parts

    • Sometimes not in the same flower

      • Sometimes will be a male flower and female flower

    • Sometimes not in same individual 

      • May need two different individuals for it to happen

    • Produces two different types of gametes

      • Pollen: male gamete

        • Much smaller

      • Ovule: female gamete

Somewhere in this process, cells with different number of chromosomes must exist. This is meiosis

Chromosomes are replicated in the S phase of the cell cycle

During mitosis, each chromosomes (regardless of pair) line up in the middle and segregate into new daughter cells

This occurs in anaphase (pmAt)

Because humans have 23 pairs of chromosomes, our nuclear genomes are considered diploid.

  • Humans, we spend our entire lives as diploids, our chromosomes always exist paired

  • Our somatic cells only exist as paired

  • Only gametes (sperm and egg cells) are haploid

    • Don't have homologous pairs because they have separated through meiosis

Haploid human gametes have 23 (unpaired) chromosomes, half as many as other cells

Meiosis

Haploid gametes cells require nuclear division that cuts the number of chromosomes in half - meiosis (m!)

A way to think is meiosis as mitosis (M!) happening twice in succession

Meiosis contributes to genetic variety

Meiosis is a reduction division

  • Starting cell has 46 and then gametes has 23

Interphase before meiosis starts

  • Chromosomes are duplicated, you still say there's 46 chromosomes but it's just there 92 chromatids

Meiosis you still use PMAT

  • You go from 46 to 23, which means you decide twice,

  • You do PMAT two times

    • So there are numbers in the phases

Prophase (1) - pro=before all other stages start

  • Chromosomes condense and thickens

  • And line up with their homologous pairs

    • Homologous means they're the same size and contain the same types of genes in the same location

  • They cross over during this phase

    • Chromosomes line up and transfer their genetic information

      • Little genetic exchange

    • Creates recombinant chromosomes

      • Eventually contributes to the variety that siblings have even when they have the same parents

Metaphase (1) -M=middle

  • The chromosomes are lined up in the middle as pairs 

Anaphase (1) - A=away

  • They are pulled away by the spindle fibers

Telophase (1) - T= two

  • Two newly formed nuclei

  • Then you end miosis one with two new cells

  • Cytokinesis splits it into two cell

Meiosis 2 is similar to mitosis

Prophase (2)

  • No crossing over

  • No homologous pairs

  • Spindles start to form 

Metaphase (2)

  • Chromosomes line up in the middle and this time they're in a single file line

  • Not in pairs

Anaphase (2)

  • Chromatids that are pulled away by the spindle fibers

Telophase (2)

  • Nuclei reforming 

  • Now there’s 4 cells forming

Meiosis in males form sperm and females form egg cells

The result are not identical to the original or each other

  • This results in variety

Nondisjunction

  • When a cell receive too many or too little chromosomes in the separation 

  • This contributes to genetic disorder

Crossing over

  • Happens during metaphase one

  • Important source of genetic variation in offspring

  • The same genes will have a slight variation even if same function

  • Each of these genes have two “versions” or alleles (A and a)

  • This shuffling may not always be the same every time gametes are produced

If crossing over did not occur (it may not always), what combination 

of the three genes might appear in gametes (and in what ratios)?

  • Expect ABC, ABC, abc, and abc

  • Because in the photo you split the pairs and then split the pairs into half again and that will give you that result

In the case of crossing over, what combination happens?

  • So you have ABC, ABc, abC, and abc

Most fungi exist as haploids - gametes form from mitosis and not meiosis

  • Mating results in a diploid and meiosis returns the organisms to haploid 

LECTURE 15

Errors in meiosis (nondisjunction)

  • Typically results in an incorrect number of chromosomes in gametes

  • More frequent with age

  • Either too many or too little chromosomes

  • In meiosis one where they fail to separate properly

  • In meiosis two and two of the cell will have incorrect number of chromosomes

What are some potential downstream consequences?

  • Important for animals to have proper number of chromosomes for properly functioning cells

    • Animals do not really tolerate changes in chromosomes well

    • Relate back to molecular biology

      • Think gene expression and the amount of protein made

What happens when an animal carries an extra (or one less) of any particular chromosome?

  • Correlates to the amount of proteins being made

  • Has one less or more place for RNA polymerase for it to transcribe from 

Extra copies of larger chromosomes result in inviable embryos 

Why do larger ones usually end in embryos that don't survive?

  • Because they contain more information

  • Because more genes when duplicated, more genes are affected by this change

Inability to perform meiosis correctly is responsible for seedless fruits

  • Seedless bananas are triploids, meaning they have three copies of every chromosome

    • Each homologous chromosomes come in three

Plants tolerate chromosome number changes better

  • Eg : “dessert” bananas are triploids

    • Having 3 copies of 11 homologous chromosomes (33 total)

During meiosis 1 it is not possible for chromosomes to be divided properly

Embryo ends with a imbalance of chromosomes which makes it fail to develop

  • That's how it is seedless

Bananas cannot perform sexual reproduction

  • So we use propagation for asexual reproduction

    • Cutting, grafting

  • This means we have been eating the same fruits from clones of the same plants

Sexual reproduction

  • Involves production of cells where chromosome numbers change (formation of gametes cells)

  • Then they fuse back together and chromosome number returns to the same as in parents

  • Results in genetic variation to the offspring(progeny)

Asexual reproduction 

  • Process doesn't involve changes in chromosome number

  • Offspring genetically identical to the parents

Genetic variation is favored for multicellular organism

  • good for the long run

Might not be good for offspring because it might increase chances of bad combination of traits that don't favor them to live

  • Same goes the other way around and how it can be good for them

Traits are characteristics that can vary among individuals in a population

  • Offspring inherit aspects/characteristics of parents

  • Such as hair color, eye color

  • Not all traits are heritable

Hereditary or biological inheritance refers to passing of traits from parents to progeny

  • We now understand it is the passing of genetic material (DNA) forms the basis of hereditary 



In asexual reproduction, progeny should have

  • Traits identical to the parent

In sexual reproduction, progeny should have

  • Some combination of the parents traits

Gregor mendel

  • Performed experiments to educate mechanisms of hereditary

These mechanisms form the basis of classical or mendelian genetics

What makes for a good model organism in general?

  • Something easy to observe

  • Something that grows fast/get to reproductive state fast

    • Eg : tree no good because they take forever

  • Something that's easy to work with

In the case of peas

  • Easily grown

  • A number of easily distinguishable traits

  • Capable of self fertilization 

    • Pollen from same plant can fertilize ovule

  • Able to generate “pure-bred” plants with respect to a trait

Two kinds of characteristics to consider when thinking of genetics

  • Continuous variable

    • Eg: human height

    • Variety of values

  • Discrete or discontinuous

    • Eg: pea flowers

    • Either purple or white

Purebred plants :

  • Plants with purple flowers -> self pollinate-> plants with purple flowers

  • Remained the case regardless of however many generations

F1 hybrid generation

What happens if we cross bred these pure bred plants?

  • Prevailing thought was “blending” of the trait in the result of hybrid

If blending were true then we should see

  • Progeny with light purple flowers or progeny with both purple and white flowers

When mendel cross bred the purple and white flowers all he saw was purple flowers

  • Known as the F1 Hybrid generation

Then F2 hybrid generation was the F1 self pollinating

  • He found that there was a 3 to 1 ratio of purple to white flowers

  • Ratio applied to all characteristics of pea plants

Trait that vanished is recessive ;  other trait was dominant

Mendel summarized these traits were carried in some sort of hereditary unit (gene)

  • Each individual would have two of these units for each characteristic - one inherited from each parent

  • Traits for each characteristic were carried by different versions or forms (alleles) of these unit

  • These units would separate randomly into gametes 

    • They would join back together randomly

despite that F1  carries alleles for both flower colors we only see purple because it is the dominant trait

you see there are 3 purple flowers and 1 white which is the ratio of what mendel observed

  • Heritable material turns out to be DNA

  • These “units” turns out to be genes and there are different “versions” or alleles of genes

  • Meiosis segregates alleles into gametes randomly

  • Connection between genes and and individuals characteristics turns out to be much more complex

    • Not every trait will follow patterns

Speculate how alleles of a gene produce unique traits based on what you understand of molecular biology

  • Different traits are caused by similar versions of protein

    • They have slight difference in amino sequence

      •  that is important for protein function

    • They function slightly differently

  • Each version of protein is encoded by slightly different nucleotide sequences

Meiosis is responsible for the segregation of alleles

  • These are the alleles that get transmitted from parent to progeny through the passing of genetic material

LECTURE 16

Allele for dominant trait will be written in uppercase

  • For the recessive trait it will be written in lowercase

(most) organisms would have a pair of alleles for each trait

  • One from each parent

Homozygous: an individual is a homozygote for a particular trait if both alleles are the same (BB,bb)

Heterozygous: an individual is a heterozygote for a particular trait if they posses one of each allele (Bb)

How many possible phenotypes are there for flower color in peas?

  • Purple and white SO two phenotypes

Phenotype - all the observable traits of an individual (eg : colour)

Genotype - total of an individual’s genetic material, all of the combinations an allele has

  • Or the complement of alleles an individual has

  • Sometimes we talk about genotypes with respect to a single trait

How many genotypes are being shown in this punnett square

Two different phenotypes

  • purple flower

  • White flower

Three genotypes 

  • Homozygous - BB

  • Homozygous - bb

  • Heterozygous - Bb

Laws of Mendelian genetics

  1. Law of dominance

    1. In a heterozygote, the recessive trait is masked, or hidden by dominant trait

    2. Gene product from a single dominant allele is enough to cause a trait

  2. Law of segregation

    1. Alleles will separate out equally 

  3. Law of independent assortment

For a given characteristic, a dominant trait is always advantageous over a recessive trait

  • False; eg eye color, nothing advantageous or disadvantageous about both

The (bad) mutation in p53 is

  • Recessive because the mutation is masked

  • The 1st hit: it still functions but you can see the good gene and bad gene so heterozygous

A bad mutation in a proto-oncogene is

  • Dominant because one copy can start cancer

The main idea is that dominant/recessive should not be conflated with good or bad

  • Should be what happens in the heterozygous

Law of segregations - for each of the plants to be likely to occur you must have the two alleles separate into gametes in equal proportions 

Meiosis turns out to be the process responsible for the segregation of alleles

Test cross : to determine the type of genotype of a dominant trait 

Test cross for two phenotypes 

Suppose we come across a pea plant with purple flowers

What are its possible genotypes?

  • Two

  • 2 purple alleles or one white one purple allele 

Law of independent assortment

  • When mendel looked at two characteristics at a time, he found specific ratios that showed the characteristics don't influence each other in gametes

  • Alleles will assort themselves independently in gametes

For Independent assortment to be equal the genes have to be from separate chromosomes

  • When they are on the same chromosome, they are least likely to assort independently

  • Harder to separate when they are on the same chromosome : won't be able to do the flipping during meiosis


      Which pair of alleles are most likely to sort independently into gametes?

                                    B and c

                                    b and C

                                   D and E

                                   A and e  because they are from two different chromosomes

Which pair of alleles are least likely to sort independently into gametes?

                                    B and c

                                    b and C

                                   D and E   because they are on the same chromosome

                                   A and es

Linkage - some combination of alleles may not necessarily separate independently

Linkage depends on physical distance between genes

Crossing over reduces what the linkage look like


Other patterns of inheritance

  • Mendel showed some patterns of inheritance but there are other patterns of inheritance that are not from mendel

Incomplete dominance

  • Some characteristics that may result in phenotypes that are immediate in the heterozygote

  • These characteristics support the hypotheses of blending

  • Eg : breeding two flowers (one red one white) it results in pink flowers

Codominance

  • Some characteristics may have both traits show up in the phenotype of the heterozygote

  • Eg: cow that has red spots and white fur

Multiple “codominant” alleles

  • Some characteristics may have three (or more) traits, with unique patterns of phenotypes in heterozygotes

  • Eg: blood type

    • Parents are AO and BO (A,B are codominant and O is recessive)

    • Kids can have blood type AO, BO, AB, and OO

Most characteristics are influenced by multiple genes with many alleles

  • Genetics of most characteristics can be extremely complicated 

LECTURE 17

Forward genetics

  • Blast a population with chemicals or radiation for them to be mutated

  • Look for individuals with phenotypes you're interested in

  • Look into the genetics associated with phenotype

Reverse Genetics

  • Find the gene we don't know what they do

  • Find the phenotype caused by gene

    • Eg break the gene and see what happens to the organism

Targeted mutagenesis

  • The ability to make specific mutations revolutionized how we study genetics

It made use of PCR

  • Pcr is a process to photocopy a certain segment if product and we makes use of thes

CRISPR- Cas9 : part of the “immune system” of bacteria

CRISPR are dna sequences found in prokaryote genomes

  • Repeated sequences are from previous viral infections

    • Viruses leave parts of their genome behind

  • Cas-9 is an enzyme

    • Basically cuts off whatever seems like it was from a virus by using the RNA that has been transcribed from these viral sequences 

    • If bacteria encounters similar virus, it will use the fragments to help tell enzymes to start chopping it apart

We can direct Cas9 to cut DNA precisely in living cells

Evolution

What is the ultimate sources of genetic variation?

  • Mutations or nucleotides changes

    • Usually not in a good way, as protein function is affected

    • Mistakes that DNA polymerase makes that doesn't get fixed

We should think about genetic and phenotypic variation at the level of population of the same species

Why does variation matter? (think about the phenotypes of organisms)

  • Variation is expected among individuals within a population

  • Phenotypes of an individual affects how it function and interacts with its environment

    • How the phenotypes and traits are successful in this environment 

Defining “success” of an organism

  • How effectively it is able to reproduce

  • How is it able to transfer advantageous traits

Fitness is a quantification of an individual's genetic contribution to the next generation

  • Nothing to do with survival or ability to thrive

Use it or loose it (not quite true)

  • Repeated use of a trait changes and strengthens it (and vice versa)

  • These strengthened characteristics are passed onto offspring

Giraffes neck being stretched over time. Why is this bad?

  • Not changing the genome (if you work out, that body won’t be passed onto your child)

  • Not being passed on/no gene can be passed

Towards evolutionary theory

  1. There exists variations in heritable traits within populations

  2. Some variants more successful(and more able to reproduce ) than others in a given environment

  3. The population thus changes over time with respect to this trait - this trait becomes more common

Lamarck's idea is more individualized but this is more of a population

Kettlewell's experiment conclusion : he’s the one whole let free a bunch of moths he marked to see what was left

  • There exists variations in heritable traits within populations

  • Some variants are more success (and more able to reproduce) than other in a given environment

  • The population changes over time with respect to this trait

Natural Selection : being more successful in an environment so you are being “selected”

 Abiotic

  • Temperature

  • Geography

  • Resources available

Biotic

  • Attractiveness (mating)

  • Resources available 

  • Predators

  • Diseases


Selective pressure

  • Stabilizing selection

    • Most intermediate variants are going to be the one that are favored

  • Directional selection

    • One trait is favored over another one, population gets changed towards one 

  • Diversifying selection

    • Two extremes in the spectrums are favored and the intermediate are not

Diversifying selection would easily result in new formation of species because only the population after natural selection stays. And the new population is a new species compared to the old one

Natural vs Artificial selection

  • Natural : environment providing selective pressures

  • Artificial : humans directing how populations change over time

Domestication of wild species is the best example of artificial selection

Genetic drift

  • Evolution occurring by chance

  • By chance some individuals just cannot reproduce;thus proportions of variants changes

This is more likely when populations are small

  • Change in smaller populations, it is more pronounced 

Genetic bottleneck

  • Drift to the extreme

  • Sudden loss of population can dramatically change the traits and variation of a population

  • Survivors are only contributors to gene pool

  • Usually result of a disaster 

Founder effect

  • Similar to bottle neck

  • Small population moves to a new place and there is only a handful of them in this new place

Diversity of life shares a common ancestor

  • This common ancestor no longer exists (extinct)

Evolution is continuous and shapes future life

Humans are also part of this

  • We share a common ancestor with the great apes but do not descend from them

Evolutionary theory is fundamental to how biologists think of life

LECTURE 18

Morphological species

  • Use physical similarities or differences to delineate species

  • Use by botanists, zoologist, and paleontologist 

The most popular way of defining a species now is using the concept of biological species

  • A species is a group of organisms that are capable of interbreeding, and can produce viable offspring that can also reproduce 

While it is useful, there are disadvantages

  • Recognized separate species can form hybrids

    • Mules : horses and donkeys are considered separate animals

  • Not everything reproduces sexually

  • Extinct groups are impossible to verify

  • Separate populations may still be able to interbreed

Binomial(two names)species name

  • Corn

    • Genus : Zea (always capital)

    • Specific epithet : mays

Why name them this way?

  • Standardized, “universal’ language between biologists

  • Each organism can have only one acceptable binomial name. Whereas there can be many common names

  • Common names can overlap and start confusion

Linnaean classification system : natural world into 3 categories 

  • Animals

  • Plants (or vegetables)

  • Minerals (no longer in use)

Taxonomy - field of study of classification

How did Linnaeus categorize what he observed? What criteria did he use?

  • Physical features, what they eat, how they interact with others etc… 

When does a new species arise? (takes a long time)

  • When they stop interbreeding

  • When they stop exchanging genetic information

Speciation into two broad categories (both categories relate to where the two species are when they diverge)

  1. Allopatric speciation - evolves into separate species due to geological separation (animals move into different areas and formed their own populations which then couldn’t interbreed with the original one)

    1. Allo- other ; patric - country/land 

  2. Sympatric speciation - evolves into separate species but not due to geological separation

    1. sym - same;  patric -country/land

When genes stop flowing

  • Individuals will not always stay in the same place

  • Environment suddenly change

  • Random chance and other processes that eliminate portions of the population

What mechanisms are likely to result in sympatric speciation?

  • diverging/disruptive selection

    • There's a split within the population, then slowly u consider them as separate species

Reproductive barrier- when they diverge to the point where they cannot mate and reproduce

  • Happens through temporal isolation (mating at different times)

    • Do not interbreed because reproduction happens at different times ( cant meet because they emerge at different times)

    • Common in plants and insects

    • An example of prezygotic isolation because they do not/cannot meet

  • Habitat isolation (allopatric )

    • occupy different habitats that they don't interbreed

    • It is an example of prezygotic isolation because again they do not meet

  • Hybrids not being viable (hybrid inviability)

    • Genetic dead end

    • Can interbreed but hybrid offsprings do not survive or infertile

    • Fail to survive sexual maturity results in not being able to pass the genes onto the new generation

    • An example of postzygotic isolation ; there is is fertilization of egg but they don't survive or infertile

  • Why might hybrid offspring being infertile?

    • Usually an incompatible(odd) number of chromosomes in offspring

    • So meiosis doesn't take place properly

    • That's why mules are infertile (need to separate the chromosomes, gametes separate into 31 or 32. One single unpaired. Just doesn't work out)

Prezygotic isolation (“before zygote”- zygote = fertilized egg)

  • Individuals cannot/do not physically mate

  • Sperm does not fertilize egg

Postzygotic isolation (“after zygote”)

  • Individuals can mate but offsprings are inviable (do not survive) or infertile (cannot reproduce) 

Hybridization

  • Formation of new species 

  • More likely in plants

  • Often end up reproductively isolated from their parent species

LECTURE 19

Ecology 

  • The study of interactions of living things with their environment

  • Living things do not exist in isolation, but are part of larger population and community (and beyond)

Do ecologists study at the level of single organisms?

  • Yes

Adaptations

  • Species possesses feature that allow them to succeed in their environmental interactions

Like peppered moths adapted to be a darker colour based on the environment it lived in because it was polluted 

What kind of adaptations does a polar bear have to the abiotic aspects of its environment?

  • Temperature

    • Very thick fur

  • Good sense of smell

    • To hunt prey

  • White fur 

    • Not be seen easily amongst the snow

Ecological niches

  • Each species settles into their unique ecological niches

  • Niches represent the range of resources a species can use, within the range of environmental conditions it can tolerate within an ecosystem

Can niches evolve?

  • Yes, it represents the resources a species can use, the population changes over time due to the fact that it's being eaten.

Life history 

  • Determine it's place in its environment and niche

ENERGY IS NOT UNLIMITED; there are benefits and tradeoffs for specific values of each aspect 

Aspects of life history

  • Size of mature individual

    • Large or small?

  • Timing or maturity

    • Early or late

  • Longevity

    • Long or short lives

  • Parental care

    • Extensive or not

  • Offspring number (fecundity)

    • Lots or few?

Population ecology ( like biology + economics)

  • How the populations change over time in a given environment 

  • Population ecologists measure changes in a population over time, and in response to various biotic and abiotic factors

Some important values

  • Population size (N) = how many individual of a species in a given environment 

  • Density = how many individuals within a specific area

  • Distribution = how are they spread within an area

N= number of individuals in a population

t= time span (researcher defines)

rmax= the max growth rate of the population (combines birth and death rates; a species life history determines these!)

k= carrying capacity, the maximum population size that a given environment can sustain

With infinite resources, populations should grow exponentially because if they reproduce at the same rate then it multiplies = exponential rate

Models of population growth

  • Exponential growth

    • Describes how a population changes if resources are unlimited

    • Population will increase consistently and indefinitely by a constant factor

    • Eg ; bacteria

  • Logistic growth

    • Resources are not infinite

    • Adds a limit to exponential growth model

    • As it approaches carrying capacity, it slows down

What else regulates population growth?

  • Given environment changes over time, carry constant doesn't stay constant

  • Density dependant regulation ; high population density

    • More competition for limited resources

    • Individuals easily preyed on 

    • Diseases spread faster

    • ALL of these are biotic factors

  • Density independent

  • - usually abiotic factors : seasonal changes, disasters 

    • Once temperatures cool down the population starts to crash

K selected species

  • When there's stable environmental conditions, species favor expending energy to being as competitive as possible

  • EG ; western red cedar - requires more time to grow and mature 

r-selected species

  • Not stable environmental conditions, produce a lot of environment to overwhelm the environment. Maximizes reproductive rate

  • EG ; vine maple show up more often and reproduce as quickly as possible

Carrying capacity is hard to determine

  • You need to determine what the limiting resources are for that species and their availability

Does earth have a carrying capacity for humans

  • Yes, there's a limited amount of resources available 

    • There is a carrying capacity but it is changing overtime 

Do you think humans have approached our carrying capacity

  • Yes and no because we have but we are formulating new things everyday

  • He's like we do reach carrying capacity but some motivation or the panic drives us to further extend this capacity

LECTURE 20

Community ecology

  • Concerns how species interact with each other

Populations of the same species do not exist on their own

  • They encounter and interact with other species

How do species interact with each other

  • Eating

  • Beneficial interaction

  • Symbiosis 

  • Competition 

    • Competition between the same and different species

  • Consumption

    • Eating another species as food

  • Symbiosis

    • Live together 

Niches represent the range of resources a species can use within the range of environmental conditions it can tolerate within an ecosystem

  • Nutrients it can take in

  • Species that it can eat

  • Environmental condition

    • Minimum/maximum water requirements

    • Temperature

How else can a niche change over time?

  • If traits change it influences how the ecological changes

Competition

Can two different species occupy the same niche ( use the exact same resource, live in the same environment)?

  • Sort of but not for long

  • If they are in the same area and use the same resources then that is competition 

Competitive exclusion principle

  • Species cannot occupy the same niche

  • Once they do, something will change so they don't overlap

Neither species benefit from competition

If people favor the bigger species what will happen to the smaller ones?

  • Both species or one or the other will evolve to stop each seeds of intermediate size 

Partial overlap and complete overlap

  • Partial overlap usually ends with the species modifying so they no longer compete for the same resources (resource partitioning)

  • Complete overlap usually ends up with one species could be forced out of the community or driven to extinction

Consumption

  • Heterotrophic species CONSUME other species

  • Consumers benefit but the food species do not

2 terms

  • Predation

    • One species kills and eats another(prey) for food

    • Negatively influences the population of food species

  • Herbivory

    • Where one species eats an autotroph

      • Usually only one part of the plant is eaten; the food may not necessarily be killed

      • Autotrophs like plants and algae

  • Consumption affects the population ecology of both species

Predator prey dynamics are usually out of phase of each other because the species takes time to respond

Predation and herbivory can drive evolutionary arms races

  • Species selected for adaptations to avoid being eaten and or to better acquire food

Natural selection

  • You need to thrive in order to reach a reproductive stage or age

Adaptations

  • To avoid being eaten and or to better acquire food

Adaptations against predation

Camouflage 

  • Avoid getting eaten 

  • For predators it can be so they won't be spotted when catching for prey

Warning colouration (slide 22)

  • Aposematic (warning) colouration as defense against predation

  • Colors may make them look like they taste bad, they're poisonous

  • Makes it look unpalatable

Mimicry (slide 23)

  • Müllerian mimicry 

    • All species string

    • One species has warning color and then others all have it too

  • Batesian mimicry

    • An edible animal piggybacks on the true warning of different species

    • So the monarch butterfly does taste good

    • The viceroy butterfly looks somewhat like the monarch so the predators won’t also eat it too

Adaptations against herbivory

  • Plants cannot escape their predators - how do plants defend against them?

    • They evolve to not taste good

    • Living in places that are just hard to get to

    • Releases bad smells

    • Has thorns or spikes

    • Has some toxic chemicals

    • Hard to digest

      • size

    • Unpalatable

  • Plants have also evolved adaptations to avoid or discourage herbivory

    • Be pointy 

    • Be poisonous

      • Caffeine and nicotine are alkaloids which discourage insect herbivory

Symbiosis

  • “sym”= together, “biosis”=living

  • Many different named modes but we focus on 3

    • Parasitism 

      • Parasite species benefit but host species doesn't 

      • Eg: fleas

      • Parasites take nutrients directly from its host

        • Overtime the host can die from this (not immediate)

      • Or requires the host to complete part of its life cycle

    • How might parasitism contrast with predation?

      • The death of the host may be incidental or over a long period (parasitism)

      • But predation the death is part of the process

      • Predation : immediate death

      • Parasitism : death is extended/prolonged

    • How might parasitism contrast with herbivory?

      • Parasite goes after an individual

      • Herbivory not so much

      • Herbivory - not the whole thing is being killed

    • Commensalism 

      • One species benefits, while the relationship remains neutral for each other

      • Like fish who gains a ride from a shark but the shark doesn't benefit anything

    • Mutualism

      • Both species benefit

      • Honey bees and flowers

        • Bees are important to help sexual reproduction of farming plants

        • And the flowers help the nectar

Interactions drive co-evolution

  • When all living things are constantly evolving against each other, perhaps all that can be done is to merely survive

Red queen hypothesis (from the red queen from alice through the looking glass)

  • Constantly in motion but you are in the same place

  • Species are constantly changing against each other, perhaps all that can be done is to merely survive

Community dynamics

  • Study of how community composition changes over time

Primary succession 

  • Newly disturbed place

Secondary succession

  • Has been disturbed but has adapted to adjust to this disturbanceBottom of the food chain

  • Autotrophs

  • Source of the organic carbon

Heterotrophs

  • Consumes

  • Needs to eat producers for organic carbon

In terms of sheer numbers, which trophic level should have the greatest population

  • producers(bottom of the chain

    Food webs

  • Species eat not just one type of food but things from different trophic levels (stages of food chain)

  • It's better to organize into food web

LECTURE 21

Phylogenetic trees

  • Diagrams that depict the hypothesized evolutionary relationships between taxa (groups of organisms)

    • Hard to test empirically -> we were not there to see speciation happen

    • Cannot know evolutionary relationships w 100% certainty

  • Can also summarize diversity

    • More taxa = more diverse


  • Can be constructed based on:

    • Morphological changes (physical)

    • Developmental changes 

      • Works best on multicellular organisms (plants, animals)

    • Molecular changes

      • DNA, protein sequences


  • Trees can be oriented in diff ways but they all have the same topology





  • monophyletic group (a “clade”) is an ancestral taxon and all its descendants (and only those descendants)

  • Use “snip test” to determine


  • paraphyletic group consists of the group’s last common ancestor and all its descendants except a few

    • Aves (birds) is excluded from Reptilian (reptiles)

    • This would make Reptilian paraphyletic


  • polyphyletic group includes organisms that arise from multiple common ancestors and/or excludes most descendants

    • Mammalia and Aves share a common ancestor, but that ancestor and most of its descendants are not included

    • Typically used to identify species that have undergone convergent evolution

Parallel and convergent evolution

  • Parallel: trait results from shared ancestry (homologous traits)

  • Convergent: trait results from shared lifestyle (analogous traits)

NOTE: Q: why are polyphyletic and paraphyletic groupings still so often used?

A: for historical reasons + biologists are stubborn + for convenience, if they share a uniquely common trait

  • will most likely not become monophyletic again

Examples:

Q: which is a monophyletic group?

A: reptiles, birds, and mammals


Q: which node represents the most recent common ancestor of species B and C?

A: 2



A: none of these

NOTE:

Example:


LECTURE 22

  • Diversity of life on earth (not in exam)

Biodiversity:

  • Species arise and species go extinct

  • About the diversity of living things that exist now in a given environment (or all of Earth)

Species richness: a measure of the number of diff species in an environment

Abundance: a measure of the number of individuals in an environment

  • Usually measured for each diff species separately

Molecular techniques to assess biodiversity: to try to capture as complete of a snapshot of an area’s biodiversity, biologists now turn to molecular methods

  • Can capture all the “unseen” diversity of microbial life

  • Involves extensive sequencing of DNA fragments taken directly from the environment


  • Metabarcoding: assess short genetic sequence that exist in all life

    • Most commonly used is ribosomal RNA (rRNA)

    • We have huge databases of rRNA sequences and the species to which they belong 

Relative vs. Absolute abundance: can present abundance in diff ways to compare between samples / communities / environments

  • Relative abundance depicts the proportions each taxon/species exists within the total population

  • Absolute abundance shows the actual number of individuals of each taxon/species

Why do we care about biodiversity?

  • What happens to ecosystems when the environment changes rapidly? (Eg. Due to human activity and/or climate change)

    • Some of the species may be lost (move away or die)

  • What happens when ecosystems lose diversity? (Are there biological consequences even when we attempt to restore ecosystems?)

    • May disrupt energy flows, food webs

Biodiversity loss affects:

  • Genetic diversity

  • Community interactions

  • Biological productivity

Food webs

  • Many species do not consume just one other species, and may also eat organisms from diff trophic levels

    • May be better to organize species into a food web instead

LECTURE 23 

Q: what kinds of living things are known to have viruses infecting them?

A: all living things -> bacteria, plants, fungi, animal, algae

Q: at a min., which major types of biological molecules must viruses have?

A: proteins and nucleic acids

Introduction to viruses

  • viruses are extremely small

  • Typical virus particle (“virion”) sizes from 20nm to 250nm

  • Some extremely large viruses have been found that approach the size of bacteria

  • Don’t rly know how viruses originated

    • Bits and pieces of living things


  • Virions come in a variety of shapes 


  • Viruses can be classified based on whether or not they contain a small lipid membrane:

    • Naked” viruses do not contain a lipid membrane - the virion usually consists of just a protein capsid protecting the genome within

    • Enveloped” viruses contain a small envelope of lipid membrane derived from the host

      • This envelope encloses the capsid within

  • Viruses can also be classified based on how their genome is arranged:

    • whether their genome is:

      • Made of DNA or RNA

      • Single or double stranded

      • Directly readable by a ribosome (think bk to template and coding strands)

Central dogma of molecular biology: DNA -> (transcription) -> RNA -> (translation) -> protein

  • Reverse transcription = RNA -> (transcription) -> DNA

Viruses reproduce by exploiting their host cell’s normal functions to generate more copies of themselves:

  • Which cellular functions are exploited?

    • Ability to replicate DNA

    • ATP from cell

    • Protein production machinery (ribosomes)

Since viruses exploit (and therefore disrupt) cellular processes, viruses are agents of disease

  • Viruses are examples of pathogens

Disease: a condition that impairs normal cellular or tissue function; may cause death

Pathogen: an entity that causes disease in a host

How do viruses infect?

  • Viruses generally infect their host and reproduce in these steps:

  1. Attach to the host

  2. Enter the host

  3. Make virus parts (viral proteins/genome)

  4. Assemble new virions

  5. Leave the host

SARS-CoV-2:

  • The virus responsible for COVID-19

  • Severe acute respiratory syndrome coronavirus 2

  • Pathogen is SARS-CoV-2

  • Disease is COVID-19

    • Coronavirus disease, 2019

  • Various tests for SARS-CoV-2 detect the presence of diff parts of the virus (nucleoprotein (N))

  • Nucleic acid PCR tests attempt to detect a part of the genome (genomic RNA)

Analyzing viral genomes

  • Building phylogenetic trees w viral genome sequences help us determine relationships between viruses circulating in a given area or between parts of the world

How do viruses infect? (SARS-CoV-2)

  1. Attach to the host




Q: the normal function of the ACE2 receptor is to bind to coronaviruses 

A: false

  • In humans, ACE2 normally plays a role in regulating blood pressure and fluid/electrolyte balance

  • Viruses exploit this protein to gain entry into host cells


  1. Enter the host


A: Endocytosis

  • some viruses (not SARS-CoV-2) only inject their genetic material into the cell


  1. Make virus parts

    The genome of SARS-CoV-2 is single-stranded RNA

    • Coronaviruses are not retroviruses

    • To make new copies, this piece of RNA serves as a template to make complementary RNA

      • These pieces of complementary RNA are not still readable by a ribosome

NOTE: Q: the host cell has enzymes that can make RNA using RNA as a template

A: false

  • Some viruses (not SARS-CoV-2) merge/integrate their genetic material w the host genome

    • Eg. HIV, herpesvirus

    • These viruses remain w us for life

      • Can reactivate -> transcription and translation of those viral genes lead to new visions being produced

      • Or they do nothing after the initial infection

    • Huge implications on how genomes mutate, evolve


  1. Assemble new virions

  2. Leave the host

SARS-CoV-2:

  • The viral replication process heavily damages the host cell

    • Leads to a disease state for the organism

      • COVID-19 symptoms

Viruses:

  • Do not maintain stable internal environment

  • Do not respond to external stimuli

  • Are not considered as cells



What changed such that COVID-19 followed exponential growth?

  • We found out ppl could quickly become reinfected to covid; hosts started to become unlimited which meant we would need to follow exponential growth in later models

LECTURE 24

Ecology of viruses

  • Parasitism 

    • Virus needs time to make sure cell stays alive long enough to make lots of copies of itself

Viruses play huge roles in all ecosystems; If all viruses disappeared today, what might happen? 

  • Population will expand

  • They contribute to evolution in all kinds of living things… this would significantly be impacted

  • We would be overrun with bacteria

Interactions between viruses and their hosts contribute to selections and evolution in the host; in what kinds of traits, features, or changes might we expect selection to take place, and in what way?

  • evolution establishment development of an elaborate immune system

Q: do concepts of evolution and natural selection also apply to viruses?

A: yes

What is the ultimate source of genetic variation?

  • Mutations or nucleotide changes

    • Usually not in a good way, as protein function is affected



Q: Which parts of the virus could be subject to selection? Which parts are likely to evolve faster?

A: any sort of surface protein for viruses tend to be selected for quite strongly

Intro to the immune system

  • pathogens (like viruses) drove the evolution of immune systems in animal, but also in plants 

  • In animal, we have two main kinds:

    • Innate immunity: recognized general signs of pathogens, always present, indiscriminate/non-specific, fast 

    • Adaptive immunity: triggered by infections, specific to a pathogen, slow, generates immunological memory

Antibodies:

  • Adaptive immunity is extremely complex

    • Depends on antibody interactions w the pathogen

  • Antibodies are a key part of the adaptive immune system

    • These proteins are also called “immunoglobulins”

    • Are the easiest to understand

    • Antibodies bind to antigens that are not “self”

      • Triggers an immune response

      • If antibodies bind to antigens that are harmless substances or parts of itself…

        • Allergies

        • Autoimmune disease

Q: generally, antibodies bind to antigens of the matching…

A: shape

  • Antibodies are specific -> they only interact w antigens (eg. Part of a pathogen) that they can bind to

  • Encounters w antigens result in more of the matching antibodies being made

  • If 2 antigens are similar enough, antibodies generated for 1 antigen may be cross-reactive to the other



Q: diff antibodies for diff antigens must have diff amino acid sequences

A: true

Antibodies:

  • Physically block interactions

  • Mark those substances for destruction

  • Encounters w antigens result in a sudden increase in the matching antibodies being made

  • These antibodies, and the cells that made them, remain in our blood - immunological memory

    • If pathogens come bk, body is ready to restart process



Vaccines:

  • Variolation was an old technique that used scabs from an infected individual to hopefully induce a milder form of smallpox and result in future immunity

  • Individual who were previously infected w cowpox (much milder disease) did not get smallpox (more devastating)

    •  Antibodies against cowpox are cross-reactive against smallpox

  • Further developments led to these types of vaccines:

    • Attenuated vaccines: uses weakened (but still alive) pathogens

    • Inactivated vaccines: uses killed or no longer virulent (disease-causing) pathogens

    • ^ Both tend to produce strong immune responses

    • Subunit vaccines: only a part of the pathogen is used

      • Surface proteins on any pathogens, either viruses or bacteria, are often used to make these vaccines

      • MRNA vaccines help us make this subunit w our own bodies




NOTE: in 1980, smallpox have been eradicated

  • remains the only human disease to ever have been eradicated