BIO ALL QUESTIONS

Morgan has diabetes and must carefully monitor his food intake. He is

learning the calorie count of the different macromolecules—carbohydrates,

proteins, and fats—so that he can make choices to keep his blood sugar in the

proper range. He notices that the word calorie is sometimes spelled with a capital

C. Which statement accurately describes calories and Calories?

a. A kilocalorie is equal to 1000 Calories.

b. A Calorie is equal to 100 calories.

c. A calorie is equal to 1000 Calories.

d. A Calorie is equal to a kilocalorie.

2. Mariana eats an orange. Which statement describes the ultimate source

of the energy that her body receives when she digests the orange?

a. Organic matter, rich soil in which the orange tree grows, and adequate water

all work together to generate the energy that can be derived from the orange.

b. The light energy that originates from the sun provides the energy to grow

oranges, which contain macromolecules.

c. The orange tree obtains energy from the nitrogen compounds and other

compounds in fertilizer.

d. The orange contains the energy-rich nutrients that it draws from the soil.

3. The molecules in the food we eat contain chemical energy stored in

chemical bonds. Which statement BEST explains how this energy is released?

a. Cells burn food molecules, releasing energy as heat that powers movement

while keeping the body at the correct temperature.

b. Chemical energy is released as eaten food is digested, giving off heat as a

by-product.

c. Cells extract and capture the energy in food molecules all at once, then store

it for later use.

d. Chemical bonds in food molecules are broken, releasing energy and allowing

cells to use the energy to make ATP.

4. Natasha is making a model of cellular respiration. Her model shows the

pathway followed when there is enough oxygen available. What does Natasha’s

model show?

a. an aerobic pathway consisting of glycolysis and fermentation

b. an anaerobic pathway consisting of glycolysis and fermentation

c. an aerobic pathway consisting of glycolysis, the Krebs cycle, and the electron

transport chain

d. an anaerobic pathway consisting of glycolysis, the Krebs cycle, and the

electron transport chain

5. The process of combustion, or burning, is very similar to the chemical

processes that release energy in cells. Wood burns at a very high temperature,

about 600C. Which two statements explain how the human body is able to

obtain energy without becoming too hot? Select two answer choices.

a. A large percentage of the cell is protein, which prevents rapid combustion.

b. The breakdown of glucose occurs in many small steps.

c. Low-temperature breakdown oxidation of glucose is enabled by enzymes that

catalyze specific reactions.

d. Both fuel and ample oxygen are required for fire; oxygen concentration is too

low in the body to allow combustion.

6. The overall reactions for photosynthesis and cellular respiration are

opposite. Select two statements that describe the two processes.

a. Photosynthesis uses carbon dioxide from the atmosphere and produces

oxygen.

b. Cellular respiration uses carbon dioxide from the atmosphere and produces

oxygen.

c. Photosynthesis uses oxygen to release energy from food and produces

carbon dioxide as a byproduct.

d. Cellular respiration uses oxygen to release energy from food and produces

carbon dioxide as a byproduct.

7. Glycolysis is the first stage of cellular respiration and is an anaerobic

process. During glycolysis, glucose is converted to two molecules of pyruvic acid.

How is glycolysis kept functioning during cellular respiration?

a. Two high-energy electrons are passed to the carrier NADH, which transports

electrons back to glycolysis.

b. Two molecules of ATP from the cell are invested at the beginning of the

process of glycolysis.

c. Pyruvic acid from glycolysis reacts to form acetyl-CoA, which then combines

with a four-carbon compound in the Krebs cycle and re-enters glycolysis.

d. H + ions pass back across the mitochondrial membrane through chemiosmosis

and re-enter glycolysis.

8. Savannah is asked to explain the locations of the stages of cellular

respiration. What location should she give for the site of the Krebs cycle

reactions?

a. the cell membrane, which surrounds the cell

b. the nucleus of the cell

c. the matrix of the mitochondria

d. the cytoplasm of the cell

9. Celeste and Raymond are studying the differences between prokaryotes

and eukaryotes. They learn that in eukaryotic cells the electron transport chain is

in a different location than in prokaryotic cells. Which statements give the correct

explanation of this difference? Select two answer choices.

a. In prokaryotes, the electron transport chain is in the nucleus.

b. In eukaryotes, the electron transport chain is composed of a series of

electron carriers located in the inner membrane of the mitochondrion.

c. In eukaryotes, the electron transport chain is composed of a series of

electron carriers located in the Golgi apparatus.

d. In prokaryotes, the electron transport chain is in the cell membrane.

10. The Krebs cycle consists of many small steps, each catalyzed by a

protein enzyme. What is another name for the Krebs cycle?

a. the pyruvic acid cycle

b. the carbon dioxide cycle

c. the citric acid cycle

d. the Calvin cycle

11. ATP, a higher energy molecule than ADP, is synthesized from ADP in the

electron transport chain. Given that molecules cannot go from a lower energy to

a higher energy on their own without an external input of energy, how does the

energy for this reaction enter the system?

a. Energy enters the system when NADH and FADH 2 carry their high-energy

electrons to the electron transport chain where, through chemiosmosis, their

energy is used to transport hydrogen ions across the membrane into the

intermembrane space, causing the buildup of a charge difference.

b. Energy enters the system when NAD + and FAD carry their high-energy

electrons to glycolysis, where, through kinesis, their energy is used to

transport acetyl-coA across the membrane into the intermembrane space,

causing the buildup of a charge difference.

c. Energy enters the system when NADH and FADH 2 carry their high-energy

electrons to the Calvin cycle where, through chemiosmosis, their energy is

used to transport hydrogen ions across the membrane into the

intermembrane space, causing a higher concentration of hydrogen ions.

d. Energy enters the system when NAD + and FAD carry their high-energy

electrons to the electron transport chain where, through chemiosmosis, their

energy is used to transport hydrogen ions across the membrane into the

matrix, causing the buildup of lactic acid.

12. ATP is produced in all stages of cellular respiration. Which two

statements describe the process of ATP synthesis in the electron transport

chain? Select two answer choices.

a. The ATP synthase spins when the hydrogen ions rush past, acting as a

"matchmaker" and grabbing another phosphate group to attach to an ADP

molecule.

b. The high concentration of NAD + acts as a catalyst to speed up the formation

of ATP from ADP.

c. The high concentration of hydrogen ions in the intermembrane space allows

them to diffuse back across the membrane into the matrix.

d. The FADH 2 synthase spins as the high-energy electrons rush past,

synthesizing ATP from ADP.

13. In the process of glycolysis, four ATP molecules are synthesized from

four ADP molecules. Why does glycolysis not yield four molecules of ATP?

a. Two ATP molecules are lost in the cytoplasm.

b. Two ATP molecules are converted immediately back to ADP.

c. Two ATP molecules are required to start the process.

d. Two ATP molecules are absorbed in the mitochondria.

14. Jose and Rema are making sourdough bread. They have been feeding

the starter dough for a week now, and it has undergone lactic acid fermentation.

They mix the dough and add a portion of the starter, which will give the bread its

famous texture and sour flavor.

What process will occur next to make the dough rise?

a. Alcoholic fermentation takes place and ethyl alcohol and CO 2 gas are formed,

creating pockets in the dough.

b. Alcoholic fermentation takes place, and the yeast give off oxygen, creating

pockets in the dough.

c. Alcoholic fermentation takes place, and during the Krebs cycle, CO 2 is

produced, creating pockets in the dough.

d. Alcoholic fermentation takes place, and the H 2 O byproduct of the electron

transport chain vaporizes to create pockets in the dough.

15. Xavier and Jill are practicing the 100-meter sprint. Which statement BEST

describes the metabolic pathways their muscles will utilize to produce the quick

energy needed for this intense exercise?

a. Glucose is converted to pyruvic acid, followed by the aerobic pathways of the

Krebs cycle and the electron transport chain.

b. Glycolysis produces pyruvic acid and 2 molecules of ATP, then in the

absence of oxygen, alcoholic fermentation regenerates NAD + to keep

glycolysis running.

c. The pyruvic acid from glycolysis enters the mitochondria and is broken down

in the Krebs cycle.

d. Glycolysis begins glucose metabolism, and in the absence of oxygen, lactic

acid fermentation takes over.

18. Air and water pollution from industrial waste is a major global challenge,

and is largely driven by societal needs and wants. Biochemists know that plants

function as small chemical factories, yet produce no toxic waste. These tiny

factories in plants are everywhere, synthesizing carbohydrates from

photosynthesis, utilizing cellular respiration for energy production, and producing

food for animals all at the same time.

How can this knowledge, along with modern technology, BEST be applied

to reduce industrial pollution?

a. Hazardous industrial wastes can be treated with fertilizer and spread on

croplands.

b. Plants can be genetically modified to synthesize compounds that currently

are made in chemical factories that produce hazardous wastes.

c. Plants can be genetically modified to transform heavy metals, such as lead

and mercury, into less toxic elements.

d. DNA fingerprinting can be used to identify plants that could naturally

decontaminate industrial wastes.

1. The diagram shows the structure of adenosine diphosphate (ADP).

What describes the conversion of ADP to ATP?

a. an input of energy as both phosphate groups detach

b. a release of energy as one phosphate group detaches

c. a release of energy as a third phosphate group is attached

d. an input of energy to attach a third phosphate group

2. Stuart is listing the changes to matter and energy that occur during the

process of photosynthesis. Which of these examples should he include in his

list?

a. nuclear changes that convert hydrogen and oxygen into carbon

b. chemical changes that convert carbohydrates into smaller molecules.

c. changes that convert light energy into chemical energy stored in

carbohydrates

d. changes that convert chemical energy into heat and light

3. Nancy is explaining why chlorophyll is classified as a plant pigment and

how it is useful in photosynthesis. Which property of chlorophyll would be most

appropriate for her to cite?

a. chlorophyll’s ability to absorb light

b. chlorophyll’s green color

c. chlorophyll’s presence in chloroplasts

d. chlorophyll’s reactivity with oxygen

4. Yasmine is asked to describe the structural organization of chloroplasts.

She writes the following sentence:

“A chloroplast contains thylakoid stacks, called stroma, that are surrounded by

fluid-filled grana.”

Which change to the sentence is necessary to make the sentence accurate?

a. Replace “grana” with “chlorophyll.”

b. Replace “stroma” with “chlorophyll.”

c. Exchange the positions of “stroma” and “grana.”

d. Exchange the positions of “thylakoid” and “stroma.”

5. Xavier is describing the role of electron carriers, such as NADP + , in

photosynthesis. Which property of NADP + should Xavier cite?

a. the chemical bonds formed by electrons in its molecular structure

b. its ability to accept and release high-energy electrons and a hydrogen ion

c. its reactivity with oxygen, water, and carbon dioxide

d. its ability to emit a stream of electrons in a nuclear reaction

6. What best describes the role of light in the overall process of

photosynthesis?

a. Light provides the energy for breaking apart sugars into small molecules.

b. Light provides the energy for assembling small molecules into sugars.

c. Light accepts the energy that is released by small molecules.

d. Light accepts the energy that is released by sugars.

7. By analyzing this equation, which property of photosynthesis can be identified?

a. the chemical changes that occur during the light-independent reactions

b. the chemical changes that occur during the light-dependent reactions

c. the source of carbon atoms in the carbohydrate product

d. the identities and roles of electron carriers

8. During photosynthesis, what best describes the role of the compound with

the chemical formula C 6 H 12 O 6 ?

a. a product that is not useful because of its low-energy chemical bonds

b. a product that is useful because of its high-energy chemical bonds

c. a reactant that is useful because of its high-energy chemical bonds

d. either a product or a reactant, depending on whether the cell needs to store

energy or release energy

9. What best describes the roles of photosystem I and photosystem II in the

process of photosynthesis?

a. They form ATP as hydrogen ions cross the thylakoid membrane.

b. They absorb sunlight and distribute the energy as heat.

c. They transfer electrons from a series of intermediates to form NADPH.

d. They absorb sunlight and transfer the energy to electrons.

10. Which is the role of the electron transport chain in the process of

photosynthesis?

a. cycling electrons between photosystem I and photosystem II

b. adding energy to the electrons that enter photosystem I

c. carrying electrons from photosystem II, to photosystem I, to NADP +

d. removing electrons from the chloroplast

11. During the light-dependent reactions of photosynthesis, which event must

occur for ATP synthase to function properly?

a. Hydrogen ions must pass through a channel within ATP synthase.

b. Molecular oxygen must combine with ATP synthase.

c. A molecule of ATP must release a phosphate group to become ADP.

d. Photosystem I and photosystem II must be deactivated.

12. Daniel is developing a model of the light-independent reactions of

photosynthesis, also known as the Calvin cycle. How should the model show

how carbon compounds enter and exit the cycle?

a. enter as glucose, exit as carbon dioxide

b. enter as glucose, exit as 3-carbon molecules

c. enter as carbon dioxide, exit as 3-carbon molecules

d. enter as elemental carbon, exit as 6-carbon molecules

13. In a key or legend for the model, how should William describe the roles of

NADPH and ATP in the light-independent reactions?

a. providing the oxygen for sugar molecules

b. providing the carbon for sugar molecules

c. absorbing the energy of light and transferring it to electrons

d. supplying the energy necessary to assemble sugar molecules

14. To revise the model, William wants to use color to identify the reactants of

photosynthesis. Which labels should he color?

a. H 2 O and O 2

b. O 2 and CO 2

c. H 2 O and CO 2

d. H 2 O, O 2 , and CO 2

15. The model includes a wavy arrow to show light striking the thylakoids.

Which label for the wavy arrow would be MOST USEFUL for communicating the

role of light in photosynthesis?

a. Light is radiated from the chloroplast during the light-independent reactions.

b. Light energy is cycled within the thylakoid.

c. The chloroplast reflects the green wavelengths of light.

d. Light is the energy source for converting ADP to ATP, and NADP + to NADPH.

17. In the diagram, an arrow leads from the splitting of water, to the two

photosystems, and then to NADP + . What process is represented by this arrow?

a. the formation of high-energy sugars

b. the cycling of light energy within the photosystems

c. the movement of electrons along the electron transport chain

d. the conversion of electrons into sunlight

18. The concentration of hydrogen ions is greater inside the thylakoid than

outside. Which reaction releases hydrogen ions inside the thylakoid?

a. the break-up of water molecules

b. the formation of water molecules

c. the break-up of NADPH

d. the formation of NADPH

20. If the scientist’s predictions are shown to be accurate, then which

conclusion about photosynthesis do they support? (HINT: Apply scientific

principles such as the Law of Conservation of Mass.)

a. All of the matter in water is converted into oxygen gas.

b. All of the matter in carbon dioxide is converted into oxygen gas.

c. All of the matter in carbon dioxide is converted into sugars.

d. Some but not all of the matter in carbon dioxide is converted into sugars.

21. What is the main role of carbon dioxide during the process of

photosynthesis?

a. Carbon dioxide is a waste product that is released into the atmosphere.

b. Carbon dioxide is used to assemble sugars, the main product of

photosynthesis.

c. Carbon dioxide is used to accept electrons and transfer them between

photosystems.

d. Carbon dioxide is used to transfer energy from the light-dependent reactions

to the light-independent reactions.

22. The table that the scientist constructed does not include light. Describe

the role of light in the scientist’s experiment. Then propose an explanation for

why light was not included in the table.

a. Light provides the energy for the chemical reactions that take place during

photosynthesis, and the table includes only matter, not energy.

b. Light provides the matter for the chemical reactions that take place during

photosynthesis, and the table includes only energy, not matter.

c. Light is a product of the chemical reactions that take place during

photosynthesis, and the table includes only reactants, not products.

d. Light plays no role in the scientist’s experiment and therefore was not

included in the table.

23. Under normal conditions, gases diffuse through small holes in the leaves

of a plant. When the weather is very hot and dry, plants may close these

openings to conserve water. How are the closures most likely to affect

photosynthesis?

a. They increase the rate of photosynthesis by increasing the amount of water in

the leaf.

b. They decrease the rate of photosynthesis by preventing carbon dioxide from

entering the leaf.

c. They increase the rate of photosynthesis by increasing the amount of oxygen

in the leaf.

d. They have little or no effect on photosynthesis because gases do not take

part in the process.

24. Plants depend on a wide variety of carbon compounds, including

carbohydrates, lipids, and proteins. What best describes the role of

photosynthesis in producing these compounds?

a. Photosynthesis produces ATP and NADPH that can be converted into other

compounds.

b. Photosynthesis produces 12-carbon molecules that can be broken apart into

smaller compounds.

c. Photosynthesis produces 3-carbon molecules that can be converted into

other compounds.

d. Photosynthesis directly produces all classes of carbon compounds.

25. Researchers have been developing an artificial leaf, a device that mimics

the actions of photosynthesis. The artificial leaf harnesses the energy of sunlight

and uses it to provide energy for a series of chemical reactions. Potential

products include hydrogen gas (H 2 ) and methane gas (CH 4 ). What is one way

that the chemical processes of the artificial leaf are similar to photosynthesis?

a. The products are molecules made of 5 atoms at the most.

b. The products contain carbon, but not oxygen.

c. The products contain high-energy chemical bonds.

d. Carbon dioxide is released as a waste product.

1. Mendel was a careful researcher who studied the inheritance of certain

traits in garden peas. Which research practices did Mendel use? Choose all that

apply.

a. He crossed true-breeding pea plants.

b. He allowed eggs to be fertilized only by self-pollination.

c. He analyzed his data mathematically.

d. He controlled variables by studying one or two traits at a time.

2. Mendel studied 7 traits in pea plants. One of the monohybrid crosses he

made was between plants with round seeds (R) and plants with wrinkled seeds

(r). All of the seeds in the F 1 generation had a round shape.

Next, Mendel allowed the peas in the F 1 generation to self-pollinate, forming the

F 2 generation. What describes Mendel's observations and conclusion about the

F 2 generation?

a. Three fourths of the F 2 plants show the round seed phenotype and carry the

dominant allele for roundness.

b. One fourth of the F 2 plants show the round seed phenotype and are

heterozygous for roundness.

c. The F 2 plants are all heterozygous.

d. The F 2 plants all have wrinkled seeds, and some carry the allele for round

seeds.

3. The Punnett square shown below describes a cross between two pea

plants. The letter T represents the dominant allele for tall plant height, and the

letter t represents the recessive allele for short plant height.

What were the genotypes of the parents that produced the offspring in the

Punnett square?

a. Tt for both parents

b. TT for one parent, tt for the other parent

c. TT for one parent, Tt for the other parent

d. TtTt for both parents

4. Study the Punnett square shown here. It describes the potential offspring

of a cross between two parents.

What phenotypes will be shown by the offspring?

a. All offspring will show the recessive phenotype for this trait.

b. All offspring will show the dominant phenotype for this trait.

c. Half of the offspring will show the dominant phenotype and half will show the

recessive phenotype.

d. Three fourths of the offspring will show the dominant phenotype and one

fourth will show the recessive phenotype.

5. Which two genes are most likely to be affected by a crossing-over event?

a. a pair of genes located adjacent to each other on a chromosome

b. a pair of genes separated by a third gene on a chromosome

c. a pair of genes located at opposite ends of a chromosome

d. a pair of genes located on different chromosomes

6. These homologous chromosomes carry different alleles of the wild type

and mutant type in the fruit fly Drosophila.

A cell with the homologous chromosomes undergoes meiosis, and gametes are

produced. Is it possible for a chromosome of a gamete to contain the alleles for

gray body and brown eyes?

a. Yes, because chromosomes are not generally inherited as units.

b. No, because chromosomes are always inherited as complete units.

c. No, because crossing over occurs only during mitosis, not meiosis.

d. Yes, because homologous chromosomes may exchange segments by

crossing over during meiosis.

9. A yellow seeded, purple flowered heterozygous plant (YyPp) is crossed with a

green seeded, white flower plant (yypp). (Y = yellow seed allele; y = green seed

allele; P = purple flower allele; p = white flower allele)

What is the probability that an offspring of this cross produces plants with green

seeds and white flowers? Assume the traits assort independently.

a. 0

b. 0.25

c. 0.5

d. 0.75

10. How many different gametes can be produced by a tall, yellow-seeded,

purple- flowered, and wrinkled-seeded pea plant? The genotype of the pea plant

is TtYyPprr.

a. 2

b. 4

c. 6

d. 8

11. What happens to the two cells formed at the end of meiosis I? Choose

two correct answers.

a. Four haploid daughter cells are formed during meiosis II.

b. Four diploid gametes are produced during meiosis II.

c. Each chromosome is replicated and pairs with its homologous chromosome.

d. Chromosomes do not replicate and the paired chromatids separate.

12. Which event occurs in prophase I of meiosis, but not prophase of mitosis?

a. Sister chromatids separate and move to opposite poles.

b. All chromosomes line up in a single row at the center of the cell.

c. Homologous pairs separate and move towards opposite poles of the cell.

d. Homologous chromosomes pair to form a tetrad, and may cross over.

13. A plant’s stem length distribution was graphed from the F 1 generation of a

cross. Seven categories of stem length phenotypes were observed.

What pattern of inheritance is suggested by the graph?

a. polygenic inheritance

b. multiple alleles

c. codominance

d. incomplete dominance

14. What are the possible genotypes of a person with type A blood?

I. I A I A

II. I A I B

III. I A i

a. III. only

b. I. and II.

c. I. and III.

d. I., II. and III.

15. What type of pattern of inheritance is represented by the genetics of

human blood types? Select all the answers that apply.

a. I A and I B show incomplete dominance because both alleles are partially

expressed in blood type A and B.

b. The human blood types are an example of polygenic traits with four possible

phenotypes: A, B, AB, O.

c. I A and I B show codominance because both alleles are equally expressed in

blood type AB.

d. The human blood type gene is an example of a gene with multiple alleles:

I A , I B , i.

16. Coat color in rabbits is inherited by multiple alleles for a single gene. The

table describes the genes and their inheritance.

Coat Color in Rabbits

Alleles Phenotype (coat color) Inheritance

C Dark gray Dominant to all other alleles

c ch Chinchilla pattern of coat

color

Dominant to Himalayan and

white

c h Himalayan coat color Dominant to white

c White (albino) Recessive to all other alleles

Would it be possible to obtain a rabbit with Chinchilla coat color if one parent is

white and the other parent has a Himalayan coat color?

a. Yes, because the c allele is recessive to the c ch allele.

b. Yes, if the Himalayan parent rabbit’s genotype is c h c h .

c. No, because the parents have no alleles for Chinchilla.

d. No, because the c h allele is dominant to the c ch allele.

17. Mitochondria are often described as the powerhouses of the cell. Genetic

disorders can occur when mitochondrial mutations occur. For example, a

condition called Kearns-Sayre syndrome is caused by deletions in the

mitochondrial DNA. This genetic disorder causes weakness of the muscles and

other symptoms because the mitochondria are not able to provide sufficient

energy to the cells.

The diagram shows possible phenotypes of children with an affected

parent, or parent who has the diseases.

How is Kearns-Sayre disorder inherited? Select the best explanation.

a. Genetic disorders caused by mitochondrial mutations are examples of

cytoplasmic inheritance. Only mothers transmit mitochondrial genetic

disorders to their children. The male gametes have little cytoplasm. They do

not contribute mitochondria to the embryos.

b. Genetic disorders caused by mitochondrial mutations are examples of

polygenic inheritance, because they are transmitted from fathers to children.

Mitochondria are provided by both parents in the cytoplasm of the gametes.

c. Mitochondrial genetic disorders are inherited as a dominant trait in the egg

cell DNA, causing disease in the child.

d. Mitochondrial genetic disorders are inherited as a dominant trait in the sperm

cell DNA, causing disease in the child.

20. Which is the LEAST common phenotype in the F 2 generation?

a. plants with tall vines and red fruit

b. plants with tall vines and yellow fruit

c. plants with dwarf vines and red fruit

d. plants with dwarf vines and yellow fruit

21. What are the expected phenotype ratios in the F 2 generation?

a. 9 tall vine/red fruit; 3 tall vine/yellow fruit; 3 dwarf vine/red fruit;

1 dwarf vine/yellow fruit

b. 4 tall vine/red fruit; 3 tall vine/yellow fruit; 1 dwarf vine/red fruit

c. 2 tall vine/red fruit; 4 tall vine/yellow fruit; 2 dwarf vine/yellow fruit

d. 16 tall vine/red fruit; 9 tall vine/yellow fruit; 3 dwarf vine/red fruit; 1 dwarf

vine/yellow fruit

24. What is the expected outcome of the cross?

a. All of the offspring are heterozygous black (Bb)

b. Three fourths of the offspring are heterozygous black (Bb); one fourth are

blonde (bb)

c. Half of the offspring are heterozygous black (Bb); half are blonde (bb)

d. One fourth of the offspring are heterozygous black (Bb); one fourth are

blonde (bb)

1. Alvin is studying a model of the chemical structure of a common nucleic

acid. He observes that the nucleic acid consists of four nitrogenous bases:

adenine (A), cytosine (C), guanine (G), and uracil (U).

Alvin’s observation most strongly supports which of these conclusions?

a. The nucleic acid is a form of RNA, and is not DNA.

b. The nucleic acid is either mRNA or rRNA, but not tRNA.

c. The nucleic acid is either RNA or DNA.

d. The nucleic acid is DNA, and is not RNA.

2. There are three main types of RNA: messenger RNA (mRNA), ribosomal

RNA (rRNA), and transfer RNA (tRNA).

Which type or types of RNA contain a copy of the instructions that a gene

carries?

a. mRNA only

b. rRNA only

c. mRNA and tRNA

d. mRNA, rRNA, and tRNA

3. A molecular biologist is developing a computer model of the transcription

of a gene into RNA. Which event should be included in the model before

transcription occurs?

a. the removal of introns from the gene

b. RNA polymerase inserting itself into the gene

c. RNA polymerase binding to a region near the gene, called the promoter

d. the joining together of exons to form the gene

4. Robert is studying a long list of letters. The letters represent the order of

nitrogenous bases in a molecule of mRNA. The first several bases in the list are

shown below.

AUGCCACAGGUUCAUCCGAA…

To identify the amino acid sequence encoded by the mRNA, which would be the

most useful first step for Robert to follow?

a. Calculate the frequencies of each letter.

b. Count the number of letters in the list.

c. Separate the list into three-letter “words.”

d. Separate the list into two-, three- and four-letter “words.”

5. A molecule of tRNA includes a sequence of three nitrogenous bases

called an anticodon. What is the role of the anticodon in the process of

translation?

a. The anticodon binds to a codon on rRNA.

b. The anticodon binds to a codon on mRNA.

c. The anticodon binds to a specific amino acid.

d. The anticodon binds to the promoter, a region of DNA.

6. Translation involves several different types of tRNA molecules. Which

statement best describes how tRNA molecules assemble amino acids into a

polypeptide?

a. One tRNA molecule assembles the polypeptide, and the others assist it.

b. Three tRNA molecules assemble the polypeptide, and the others assist them.

c. Each tRNA molecules assembles a different part of the polypeptide, and all at

the same time.

d. The different tRNA molecules act in a specific order, one after the other like

an assembly line.

7. The diagram illustrates part of the function of the lac operon. It shows the

operator region (O) and a protein that is bound to it. The diagram also shows the

enzyme RNA polymerase.

What is the function of the protein that is bound to the operator region?

a. It is a repressor protein that stops transcription from occurring.

b. It is an enzyme that will allow transcription to occur.

c. It is an enzyme that will break apart the operon into three separate pieces.

d. It is lactase, the enzyme that dissolves lactose, and the product of the

operon.

8. In eukaryotic cells, how do transcription factors act to control gene

expression?

a. They remove introns from pre-mRNA.

b. They bind to regulatory regions of DNA near the genes.

c. They insert themselves into DNA near the beginning of a gene.

d. They code for the synthesis of RNA polymerase.

9. Which analogy best describes the role of homeotic genes, which are

found in many organisms?

a. They act like a switch for initiating a pattern of development and cell

differentiation.

b. They act like brakes for stopping differentiation and preserving a certain body

plan.

c. They act like a role of dice that allows for unique variations in an organism.

d. They act like mechanics that fix mistakes in DNA replication or transcription

10. A point mutation changes a codon in an mRNA molecule. Will the

mutation affect the polypeptide that forms? Why?

a. Yes. Each amino acid is specified by only one codon.

b. No. The structure of DNA, and not RNA, determines the polypeptide.

c. Maybe. Some codons are translated into two or more amino acids.

d. Maybe. Some sets of codons are translated into the same amino acid.

11. A normal polypeptide includes the following sequence of amino acids.

(Note: Each amino acid is named by a three-letter abbreviation.)

Iso-Leu-Pro-Val-His-Ser-Thr-Met

After a mutation, the amino acid sequence becomes the following:

Iso-Leu-Pro-Val-Tyr-Arg-Iso-Gly

Which of the following changes to a nitrogenous base in mRNA is most likely to

have occurred?

a. A cytosine (C) was replaced with a uracil (U).

b. A uracil (U) was replaced with a thymine (T).

c. An adenine (A) was removed and not replaced.

d. The codon ACU was removed and not replaced.

12. Polyploidy is a condition in which organisms have extra sets of

chromosomes. Scientists have observed many examples of polyploidy in plants,

including crop plants such as bananas, limes, and strawberries. What BEST

describes polyploidy in these plants?

a. a point mutation that may provide benefits to an organism

b. a chromosomal mutation that may provide benefits to an organism

c. a chromosomal change that is not a mutation, and generally harms

organisms

d. a missense mutation that occurs very rarely, and always harms organisms.

13. Which of these revisions to the model would be most useful for the

researcher to include?

a. Replace thymine (T) with uracil (U) in the DNA molecule.

b. Keep the two strands of the DNA molecule joined together.

c. Identify promoter and “stop” regions on the DNA molecule.

d. Divide the DNA molecule into pieces that are 40 to 50 bases long.

14. Which base sequence in the DNA molecule identifies the region where a

transcription factor will bind, allowing RNA polymerase to attach to the molecule?

a. AACCTG

b. TGGA

c. TATATA

d. AGGAT

15. A student claims that the mRNA will include the following base sequence.

UUGGUCCGGUACCUGGAAAUAUAUUUGAUCCUA

The researcher argues the student’s claim is faulty. The mRNA likely will not

include the sequence that the student proposes.

Which features of transcription support the researcher’s argument?

a. Transcription produces a molecule of mRNA with the same bases as DNA,

and in the same order.

b. Many base sequences are cut out of the DNA molecule before transcription

occurs.

c. Base sequence in a DNA molecule may be transcribed into introns of pre-

mRNA, or may not be transcribed at all.

d. After translation, introns and exons are added to pre-mRNA to form

completed mRNA.

17. Which conclusion about the genetic code is most strongly supported by

the evidence presented in the diagram?

a. All amino acids may be encoded by more than one codon.

b. Many amino acids, although not all of them, may be encoded by more than

one codon.

c. Every codon may be translated into two or more amino acids.

d. Many codons, although not all of them, may be translated into two or more

amino acids.

18. A sequence of mRNA contains the following bases, which are translated

as three codons.

ACUACGACA

Which amino acids are produced by this sequence? Select all of the amino acids

that apply.

a. threonine only

b. threonine and arginine only

c. threonine, arginine, and isoleucine

d. arginine, serine, and isoleucine

20. What is the independent variable of the simulated experiment?

a. the presence of mutagens

b. the frequency of mutations in mice

c. the sequence of bases in mouse DNA

d. the locations of mutated bases in mouse DNA

23. A scientist hypothesizes that the markings in a certain species of frog can

be altered by epigenetic mechanisms. Which of these observations would

provide the strongest evidence for this hypothesis?

a. Some markings are controlled by sex-linked recessive genes.

b. Genetically identical frogs develop different markings when placed in different

environments.

c. Two frogs that are closely related, but not genetically identical, have exactly

the same markings.

d. RNA polymerases bind to a region near the genes that control certain

markings.

24. A multicellular organism typically begins as a single cell, and then many

cell divisions occur to generate the cells of the adult organism. However, these

cells are not identical to the original cell, and they are not identical to one

another.

What is the most significant cause of cell differentiation in a multicellular

organism?

a. differences in the number of chromosomes per cell

b. differences in the genetic code used by different cells

c. differences in the DNA that is copied and distributed among the cells

d. differences in gene regulation and gene expression among the cells

25. Many genetic technologies involve the transferring of genes from one

organism to another. For example, a gene in human DNA codes for the

production of insulin, an important protein. This gene has been transferred to

bacterial DNA, where it remains functional. The bacteria produce human insulin

that can be harvested and given to people who lack sufficient insulin supplies.

Which property of molecular genetics is most useful for explaining the success of

the technology used to manufacture insulin?

a. Proteins called histones hold DNA in tight coils in chromosomes.

b. RNA can be “tricked” into synthesizing DNA.

c. The genetic code is identical in nearly all organisms

d. Gene expression can be controlled through epigenetic mechanisms.

1. Scientists before Darwin had proposed that living things could change

over time. Why was Darwin’s theory of evolution more powerful and useful than

the proposals of the other scientists?

a. Darwin explained the mechanism by which evolution occurred.

b. Darwin cited examples from nature that were based on observations.

c. Darwin used logical reasoning to argue that living things could change.

d. Darwin hypothesized that evidence from DNA and genes would explain how

evolution occurs.

2. Darwin collected and studied a variety of fossils. The fossils provided

clues to ancient organisms. As Darwin concluded, how did ancient organisms

compare to modern species?

a. The ancient organisms were identical to modern species.

b. The ancient organisms were larger or smaller than modern species, but

otherwise identical.

c. The ancient organisms were similar to modern species, but differed in several

ways.

d. The ancient organisms were very different from modern species, and lacked

any significant similarities.

3. Artificial selection has produced a wide variety of crop plants, livestock,

and pets. Which characteristic of artificial selection makes it different from natural

selection?

a. Humans, not the environment, select which organisms survive and

reproduce.

b. Adaptations develop gradually over many generations.

c. The stock that are reproduced are genetically identical.

d. All offspring are allowed to survive and reproduce.

4. The adaptations of a pelican include its long, pouch-like beak. Why is the

beak of the pelican an example of an adaptation?

a. The beak is a unique feature that is found only in pelicans.

b. All birds have beaks, but the beaks vary among different species.

c. The shape and structure of the beak have remained the same over many

generations.

d. The shape and structure of the beak are inherited and help the pelican

survive in its environment.

5. A variety of plants and animals live in a meadow ecosystem. According to

Darwin’s ideas about evolution, which of these meadow organisms has the

greatest fitness?

a. a snake that eats many mice, and then is eaten by a hawk

b. a large, healthy hawk that does not find a mate

c. a female mouse that has many offspring

d. a lone tree that grows in the middle of the meadow

6. Edwin is studying a population of rabbits in the neighborhood that

surrounds his home. He observes a variety of fur colors among the rabbits,

including gray, white, and brown. The rabbit fur also has a variety of markings,

including spots and bands.

Edwin argues that natural selection will occur on the rabbit population. It will

result in a change in the distribution of fur colors and markings.

Which observation would provide the STRONGEST evidence in support of

Edwin’s argument?

a. Neighborhood plants can support a large increase in the rabbit population.

b. Fur color and markings do not affect the running speed of a rabbit.

c. A new predator tends to hunt more white rabbits than gray or brown rabbits.

d. Most of the rabbits are wildlife, while some are pets.

7. John states the following claim.

“Biogeography provides evidence for the theory of evolution.”

To support this claim, which evidence would be MOST useful for John to cite?

a. A sequence of fossils shows that horses became smaller over time.

b. Polar bears and grizzly bears are similar in many ways, but are adapted to

live in different regions.

c. Farm crops developed in Asia are now raised successfully in regions all over

the world.

d. Fossils of plants and animals have been found on Antarctica, which now is

covered in ice.

8. The wing of a bird and the front limb of a mammal have a similar number

and arrangement of bones. Which evolutionary relationship explains these

similarities?

a. The wing and front limb are homologous structures; each evolved from a

common ancestor.

b. The wing and front limb are analogous structures; each evolved from a

common ancestor.

c. The wing and front limb are analogous structures; each evolved

independently.

d. The wing and front limb are vestigial structures; one evolved from the other.

9. A scientist argues that the hair of mammals and the feathers of birds are

analogous structures. If the scientist is correct, what is the evolutionary

relationship between hair and feathers?

a. Either hair evolved from feathers, or feathers evolved from hair.

b. Both hair and feathers evolved from the same structure in a common

ancestor of birds and mammals.

c. Hair evolved in mammals at the same time as feathers evolved in birds.

d. The evolution of hair in mammals occurred independently of the evolution of

feathers in birds.

10. The wings of ostriches are examples of vestigial structures. The wings

provide evidence for which of these evolutionary relationships?

a. A new bird species without wings will evolve from ostriches.

b. A new bird species that has useful wings will evolve from ostriches.

c. An ancestor of ostriches had useful wings.

d. An ancestor of ostriches had vestigial structures.

11. Charles Darwin applied a wide variety of observations to help him

develop his ideas about evolution. Which general statement describes several of

the observations that Darwin made and considered, and later incorporated into

his Theory of Evolution?

a. Species may vary from place to place, but most species are distributed widely

on all continents.

b. Fossils show that ancient species were identical or nearly identical to modern

species.

c. All species use DNA to carry and translate genetic information.

d. Species on islands tend to resemble mainland species, yet differ from them in

many ways.

12. A population of male and female goats is stranded on a large island. The

goats differ from one another in several ways, including fur color, ear shape, and

preferred food.

A scientist predicts that the average ear shape of the goats will change gradually

over time. According to Darwin’s ideas about evolution and natural selection, the

accuracy of the prediction depends on which of these conditions?

a. Certain ear shapes allow the goats to hear a wider variety of sounds.

b. Certain ear shapes help the goats survive and reproduce on the island.

c. The island provides enough food to support an increase in the goat

population.

d. The island lacks natural predators of goats.

13. Giraffes, camels, and horses share some traits, although they vary in

other traits. Which statement accurately describes the evolution of these

species?

a. Each species descended from an ancient common ancestor.

b. All three species evolved from three unrelated ancient ancestors.

c. Each species evolved uniquely, without any ancestors.

d. Two of the species descended from the other species.

14. What evidence would MOST STRONGLY support the evolutionary

relationship described in the diagram?

a. data from experiments on whale behavior

b. the number of fossil discoveries of each species

c. a comparison of the fossil skeletons of the species

d. a comparison of the ages of the fossils of each species

15. The diagram supports which of these conclusions about the three ancient

species?

a. Similar body parts among the three species, such as the mouth, legs, and

tail, are examples of homologous structures.

b. Similar body parts among the three species, such as the mouth, legs, and

tail, are examples of analogous structures.

c. The hip and shoulder bones in each of the three species are examples of

vestigial structures.

d. The hip and shoulder bones in each of the three species are examples of

analogous structures.

16. Which conclusion about the simulated beetle population does the data

support?

a. Throughout the simulation, brown is the most advantageous color for the

beetles.

b. Throughout the simulation, red is the least advantageous color for the

beetles.

c. The fitness of the beetle variants changed during the simulation.

d. In additional reproductive cycles, the maroon variants would become more

common.

17. The simulation is able to model the natural selection of a beetle

population. Which statement explains why model is useful?

a. Some beetle variants were more likely to survive and reproduce than other

variants.

b. The garden had an unlimited food supply, allowing for the growth of the

beetle population.

c. The beetles were not eaten by birds or other predators, allowing for the

growth of the beetle population.

d. All of the beetle eggs hatched, grew into adults, and reproduced.

19. According to Darwin’s theory of evolution, each beak shape is the result

of the process of natural selection. Which statement is MOST USEFUL for

explaining why different beak shapes evolved in each of the four finch species?

a. Each finch species evolved from a different ancestor, each with a unique

beak shape.

b. Ancestors of the finch species mated with other bird species that had variable

beak shape.

c. The common ancestor of the finch species displayed the same four beak

shapes of its descendants.

d. The food supply selected for beak shape as the finch species descended

from a common ancestor.

20. A scientist suggests that the first finch species to arrive on the Galapagos

Islands was an insect-eating finch, similar to the modern warbler finch (Certhidea

olivacea). If the scientist’s suggestion is correct, then how many of the four finch

species shown in the diagram could have evolved from the first finch species?

a. 1 of the 4 species

b. 2 of the 4 species

c. 3 of the 4 species

d. all 4 species

22. DeMarco is constructing an argument that the wings of the bird and insect

are analogous structures. Which statement provides the STRONGEST evidence

for this argument?

a. The two types of wings grow and develop from similar or identical embryonic

tissues.

b. The two types of wings grow and develop from different embryonic tissues.

c. The two types of wings have different shapes and sizes.

d. The two types of wings are covered in different materials.

23. DeMarco researches a variety of evidence about birds and insects. He

concludes that birds and insects are very distant relatives, yet they still have a

common ancestor. Which statement provides the STRONGEST evidence for

DeMarco’s conclusion?

a. Some birds and insects have similar diets.

b. Both birds and insects use DNA, RNA, and the same genetic code.

c. Many ecosystems support populations of both birds and insects.

d. Most birds and many insects are able to fly.

25. Darwin developed and proposed the Theory of Evolution during the

1800s. Since that time, due in part to advances in technology, scientists have

expanded their knowledge and ideas about biological systems. Which statement

describes an example of evidence acquired in the past 100 years and its

relationship to the Theory of Evolution?

a. New evidence from molecular biology provides overwhelming support that all

life evolved from a single ancestor.

b. New evidence from molecular biology provides evidence that life evolved

from many ancestors, not a single ancestor.

c. New evidence from fossils provides evidence that one species does not

descend from another.

d. New evidence from biogeography provides evidence that one species does

not descend from another.