DNA and RNA

DNA – Fundamental Characteristics

  • Deoxyribonucleic Acid (DNA)
    • The hereditary molecule that codes for genetic information and enables transmission of inherited traits.
    • Exists as a double-helix (twisted ladder) discovered by Watson & Crick (noted implicitly in double-helix mention).
    • Backbone = alternating phosphate and deoxyribose sugar; rungs = paired nitrogenous bases.

Nucleotides – Building Blocks

  • Definition: Smallest repeating structural unit of nucleic acids.
  • Each nucleotide contains three sub-units (often shown as X, Y, Z on diagrams):
    1. Phosphate group
    2. Pentose sugar (deoxyribose in DNA; ribose in RNA)
    3. Nitrogenous base (A, T, G, C in DNA; A, U, G, C in RNA)
  • Bases grouped by ring structure:
    • Purines (double ring): Adenine (A), Guanine (G)
    • Pyrimidines (single ring): Thymine (T), Cytosine (C) – in RNA, Uracil (U) replaces T.

DNA Double-Helix Geometry

  • Two strands run antiparallel (one 535' \rightarrow 3'; opposite 353' \rightarrow 5').
  • Strands held together by hydrogen bonds between complementary bases:
    • A (adenine)T (thymine)A \text{ (adenine)} \leftrightarrow T \text{ (thymine)} via 2 H-bonds
    • C (cytosine)G (guanine)C \text{ (cytosine)} \leftrightarrow G \text{ (guanine)} via 3 H-bonds
  • Visual metaphors: “DNA ladder” (sides = sugar–phosphate backbones, rungs = base pairs) twisted into a helix.

Complementary Base Pairing & Sequence Example

  • Fundamental rule: Purine pairs with pyrimidine to maintain constant helix width.
  • Sample DNA strand provided: GGCCTAGGCCCCTTATATAGCTA\text{GGCCTAGGCCCCTTATATAGCTA}
    • Complementary (opposite) strand = CCGGATCCGGGGAATATATCGAT\text{CCGGATCCGGGGAATATATCGAT} (written 3'→5' relative to original 5'→3').

RNA – Fundamental Characteristics

  • Ribonucleic Acid (RNA)
    • Usually single-stranded (can fold into hairpins/loops).
    • Backbone = phosphate + ribose (one extra hydroxyl at 2' carbon).
    • Bases: Adenine (A), Uracil (U), Cytosine (C), Guanine (G).

Major Classes of RNA & Roles

  • Messenger RNA (mRNA)
    • Temporary “photocopy” of a gene; conveys instructions from DNA to ribosomes.
  • Transfer RNA (tRNA)
    • Delivers specific amino acids to the ribosome during translation.
  • Ribosomal RNA (rRNA)
    • Structural & catalytic component of ribosomes (the protein-synthesis machinery).

Key Differences: DNA vs. RNA

  1. Strandedness: DNA double-stranded; RNA usually single-stranded.
  2. Sugar: DNA has deoxyribose; RNA has ribose (extra OH\mathrm{OH} on 2' carbon).
  3. Nitrogenous Base: DNA contains Thymine (T); RNA substitutes Uracil (U).

Reading Frames: Triplets, Codons & Anticodons

  • Genetic information is interpreted three bases at a time:
    • In DNA template: each group of three = triplet.
    • In mRNA: each three-base group = codon.
    • In tRNA: complementary three-base region = anticodon (pairs with codon during translation).

Practice Question Insights

  1. “Which molecule carries amino acids to the protein-synthesis site?” → tRNA (Answer D).
  2. RNA nucleotide diagram labelling → mark phosphate / ribose / base correctly (phosphate = circle; sugar = pentagon; base = rectangle, when using common textbook iconography).
  3. DNA segment question (sub-unit X, Y, Z)
    • A single DNA nucleotide comprises all three labelled parts → Answer D (X, Y and Z together).

Concept Connections & Significance

  • Complementary base pairing underlies replication, transcription, and translation fidelity.
  • The structural variance (extra OH in ribose) makes RNA more chemically reactive and suited for transient roles, whereas DNA’s stability preserves long-term genetic information.
  • Purine/pyrimidine pairing ensures constant helix diameter (~2 nm), critical for protein interactions (e.g., transcription factors recognizing major/minor grooves).

Ethical & Practical Implications (Implied)

  • Understanding DNA/RNA structure is foundational for genetic engineering, gene therapy, forensics, and biotechnology.
  • Knowledge of codon–anticodon pairing informs mRNA vaccine design and CRISPR guide RNA specificity.