Microbial Genetics Review

Chapter 8: Microbial Genetics, Part 1

Topics Covered

  • DNA Replication

  • Gene Expression

  • Gene Regulation

  • Mutation

  • Transfer of Genetic Material

Textbook Reference

  • 13th Edition, Pages:

    • 204-209

    • 212-214

    • 221-225

    • 229-236

Learning Objectives for Part 1

  • Define the following terms:

    • Genetics: The study of heredity and the variation of inherited characteristics.

    • Genome: The complete set of genes or genetic material present in a cell or organism.

    • Chromosome: A long DNA molecule with part or all of the genetic material of an organism.

    • Gene: A segment of DNA that contains coding for a protein or RNA molecule and is responsible for a specific characteristic in an organism.

    • Genetic Code: The set of rules by which information encoded in genetic material is translated into proteins.

    • Genotype: The genetic constitution of an individual organism, representing the alleles present.

    • Phenotype: The observable physical or biochemical characteristics of an organism, as determined by both genetic makeup and environmental influences.

  • Describe how information flows in a cell.

  • Describe how DNA serves as genetic information.

  • Explain the overall process of gene expression and the components involved (transcription, translation).

  • Define mutation and classify base substitution mutations (point mutations) by type.

Phenotype Examples and Their Relation to Genotype

  • Examples of Phenotype:

    • Ribosome structure

    • Cell wall composition

    • Presence of bacteriological products such as lactose fermentation (Lac+ or Lac).

  • Relation of Genotype to Phenotype:

    • The inherited genetic makeup of an organism, termed genotype, directly influences the phenotypic traits exhibited. This linkage is critical in understanding inheritance patterns.

Connection Between Genotype and Phenotype

  1. The phenotype of a microbe is determined by the functions of thousands of different proteins.

  2. Changes in genotype, such as mutations, can create variations in phenotype.

  3. Genotype preservation occurs through the mechanisms of DNA replication.

  4. Flow of Information: The general flow of genetic information in cells follows the pathway:

    • DNA → RNA → Protein

Prokaryotic Genetics

  • Components of Prokaryotic Genomes:

    • Genome (DNA):

    • Structure for information storage is facilitated by the nucleotide base sequence.

    • Features a complementary structure that allows for the semiconservative replication during cell division.

    • Chromosome:

    • Prokaryotic organisms typically possess a single circular chromosome.

    • Plasmids:

    • Extra-chromosomal DNA that can carry genes beneficial for survival (e.g., antibiotic resistance).

  • Gene Transmission Modes:

    • Vertical Transmission: Through generations of organisms.

    • Horizontal Transmission: Across organisms of the same generation.

Gene Expression Overview

  • The flow of genetics in prokaryotes follows:

    • Transcription: The process of synthesizing RNA from DNA, primarily using RNA polymerase to transcribe mRNA from the DNA template.

    • Translation: The subsequent process where ribosomes synthesize proteins using mRNA as a template.

  • Types of RNA Involved:

    • Messenger RNA (mRNA): Carries the genetic information from DNA.

    • Transfer RNA (tRNA): Brings amino acids to the ribosome during protein synthesis.

    • Ribosomal RNA (rRNA): Forms a major part of the ribosome's structure and function.

The Genetic Code

  • Each codon specifies which amino acid will be added next during protein synthesis.

  • Example of an mRNA Sequence:

    • 5’ GAAGGAG AUGGCAGGGUAUGCCCCAUGG 3’

  • The genetic code is characterized by:

    • Redundancy: There are 64 possible codons (triplets of nucleotides) coding for 20 amino acids.

    • Start and Stop Codons: Specific codons that initiate or terminate translation.

Mutations in Genetic Material

  • Definition: Mutations are permanent alterations in the DNA base sequence.

  • Effects of mutations may be classified as:

    • Silent: Mutation has no effect on the phenotype.

    • Lethal: Causes death to the organism or cell.

    • Beneficial: Aids in survival and adaptation.

  • Types of Mutations:

    • Auxotroph: A nutritional mutant unable to synthesize a compound required for growth; often caused by mutagens such as chemical agents or radiation.

    • Spontaneous Mutation: Arises from errors during replication, with a frequency of approximately one per 10^6 replicated genes ($10^{-6}$).

    • Types of Base Substitution (Point Mutations):

    • Involves the alteration of a single nucleotide.

    • Frameshift Mutation: Caused by the insertion or deletion of a base, shifting the reading frame and potentially leading to changed amino acid sequences or premature stop codons.

Summary of Microbial Genetics Part 1

  • The link between genotype and phenotype is fundamental, where genes (DNA) direct the synthesis of proteins (
    RNA → Protein). Both chromosomes and plasmids are integral to the prokaryote genome function, facilitating both vertical and horizontal gene transfer.

Chapter 8: Microbial Genetics, Part 2

Learning Objectives for Part 2

  • Describe the functions of plasmids and transposons.

  • Differentiate between horizontal and vertical gene transfer.

  • Compare the mechanisms of horizontal gene transfer in bacteria.

  • Explain the role and importance of recombination in genetic diversity.

Gene Transfer Mechanisms in Bacteria

  • Escherichia coli Genome Composition:

    • Comprises 88% protein-coding sequences, 0.8% tRNA and rRNA genes, and 11% regulatory sequences. Notably, 20% of the genome may originate from other microbial sources.

    • Example Comparison: K12 vs. O157 strains reflect diversity in gene content.

Mechanisms of Horizontal Gene Transfer

  1. Transformation: Uptake of free, “naked” DNA from the environment.

  2. Conjugation: Direct transfer of DNA through cell-to-cell contact (via sex pilus).

  3. Transduction: DNA transfer mediated by bacteriophages, which can either be generalized (transfer of any gene) or specialized (specific genes).

  4. Transposition: Relocation of transposons (mobile genetic elements) within or between genomes.

Fate of DNA Acquired via Horizontal Transmission

  • Options for external DNA:

    1. Degradation or use as a nutrient source.

    2. Recombination with the recipient chromosome.

    3. Co-existence as a plasmid.

  • The process of recombination is critical for genetic diversity, repair of defective genes, and the acquisition of new functions.

Recombination Process

  • RecA Protein mediates the exchange of genetic material between donor and recipient DNA.

  • Genetic recombination contributes to genetic diversity within bacterial populations.

  • Historical Context: Griffith’s 1928 experiments demonstrated transformation using Streptococcus pneumoniae, where heat-killed virulent strains could allow non-virulent strains to express new phenotypes after DNA uptake.

Plasmids and Their Functions

  • Characteristics of Plasmids:

    • Autonomously replicating entities that carry their origin of replication.

    • Different types may include:

    • Conjugative Plasmids: Facilitate gene transfer (F factor).

    • Plasmids can carry genes for virulence, catabolism, and antibiotic resistance (R factors).

    • Typically measure 2 to 25 kbp in size.

  • Conjugation Process: Involves physical contact and DNA sharing via sex pilus, facilitating genetic exchange across diverse microorganisms.

Conjugation Between Hfr Cells and F- Cells

  • When an Hfr (high frequency recombination) cell conjugates with an F- cell, the entire chromosomal DNA might not be transferred, and recombination can occur within the recipient's genome, which could retain new genes while maintaining its F- status.

Transduction Process

  • Bacterial viruses (phages) act as vehicles to transport DNA between donor and recipient cells.

  • Generalized Transduction: Random host genes can be transferred when phage particles are formed.

  • Specialized Transduction: Only specific genes are transferred, often responsible for virulence factors (e.g., toxins).

Transposons

  • Definition: Mobile genetic elements that can relocate within the chromosome or between DNA molecules (e.g., plasmids), facilitating genetic diversity and adaptation.

  • Transposon Size: Range between 700 to 40 kbp in length, with transposition frequencies from $10^{-5}$ to $10^{-7}$ per generation.