Biology 101 Final

  • Locust swarms, or gregarious locust, have potentially devastating impacts on agricultural regions across the globe. Typically, locusts are solitary animals, but ever so often they change appearance and form massive swarms. Researchers have found that the more a locust comes into physical contact with another individual, the more likely they are to make the transition. Based on the research, the change in behavior is likely 

  • Choice 1 of 3:density dependent 

  • Choice 2 of 3:density independent 

  • Choice 3 of 3 neither


  • In a human cell, maternal chromosome 1 and maternal chromosome 2 will have: 

Choice 1 of 4:The same genes and the same alleles as each other 

Choice 2 of 4:The same genes as each other but potentially different alleles 

Choice 3 of 4:The same alleles as each other but potentially different genes 

Choice 4 of 4:Neither the same genes nor the same alleles as each other 

  

Q3 2 Points Grading comment: Following a vaccine your body produces antibodies immediately. Choice 1 of 2:True Choice 2 of 2:False Q4 2 Points Grading comment: 

Question_2.png If you were given a new organism with the following traits, where would they go on the phylogenetic tree? Traits: Nontoxic, found in gut, circular DNA, not motile Choice 1 of 5:Position 1 Choice 2 of 5:Position 2 Choice 3 of 5:Position 3 Choice 4 of 5:Position 4 Choice 5 of 5:Position 5 

Q5 2 Points Grading comment: Question_46.png Which of the following is a shared ancestral trait between the leopard and house cat? Choice 1 of 5:Hair Choice 2 of 5:Carnivorous Choice 3 of 5:Retractable Claws Choice 4 of 5:B and C Choice 5 of 5:A, B, & C 

Q6 2 Points Grading comment: In a study reported in the news, “Researchers found that adults who used headphones with a screen for more than one hour per day were at a 13% higher risk for hearing loss compared to those who used headphones with their screens less than one hour. The research team randomly surveyed 3,506 people in California about their screen/headphone behaviors, as well as information about ear infections and other noises a person may encounter at work and in daily life. Participants were also given physical check-ups, including a hearing test and a physical exam of the ears and eyes. The increased likelihood of hearing loss remained, even after the researchers adjusted for risk factors such as construction noise and inner ear anatomy. The researchers found no increased risk among people who used headphones with a screen less than one hour per day. Which of the following attributes was NOT part of the study’s research design and, thus, a weakness of the study? Choice 1 of 4:Collecting data from a large sample size. Choice 2 of 4:Randomly assigning participants to control and experimental groups. Choice 3 of 4:Randomly sampling adults. Choice 4 of 4:All of the above. 

Q7 2 Points Grading comment: Picture4.jpg Based on this pedigree for a rare autosomal recessive disease, what is the probability that III-3 is a carrier of the disease trait? Choice 1 of 4:2/3 Choice 2 of 4:1/2 Choice 3 of 4:1/4 Choice 4 of 4:1/3 

Q8 2 Points Grading comment: Meiosis automatically produces diversity because ___ occurs at random. Choice 1 of 4:the number of chromosomes each daughter cell receives Choice 2 of 4:the number of cell divisions each daughter cell undergoes Choice 3 of 4:which daughter cell receives maternal and which daughter cell receives paternal chromosomes Choice 4 of 4:which of the four daughter cells receive a complete set of genetic material 

Q9 2 Points Grading comment: True or False: Natural selection creates variation within a population. Choice 1 of 2:True Choice 2 of 2:False 

Q10 2 Points Grading comment: Picture2.png Celebrities and regular people alike are using the diabetes medicine, Ozempic (semaglutide), to try and lose weight! (Side effects include stomach pain, kidney failure, vision problems, and thyroid cancer. Always read the fine print!) Based on the data above, choose the FALSE statement (A vehicle is simply a control). Choice 1 of 4:Both semaglutide-AuAuAu28-31 and semaglutide show the lowest blood glucose at 24 hours. Choice 2 of 4:Exenatide appears to work for a shorter amount of time than the other treatments. Choice 3 of 4:Liraglutide lowers glucose levels better than semaglutide before 12 hours. Choice 4 of 4:Glucose levels don’t increase beyond the initial levels with any group. 

  • Q11 2 Points Grading comment: A virus variant has evolved surface proteins that prevent your current antibodies from binding to it. This virus has evolved to evade the _ immune system. Choice 1 of 3:humoral Choice 2 of 3:cell-mediated Choice 3 of 3:neither 


  • Q12 2 Points Grading comment: Aerobic cellular respiration completely breaks down a glucose molecule through glycolysis and the citric acid cycle. However, these two processes yield only a few ATPs. The majority of the energy the cell derived from glucose is __. Choice 1 of 4:in NADH and FADH2 Choice 2 of 4:lost as heat Choice 3 of 4:passed to the oxygen used in the electron transport chain Choice 4 of 4:stored in FAD and NAD+ 

  • Q13 2 Points Grading comment: Carbohydrates are the only macromolecules that our cells can utilize for cellular respiration. Choice 1 of 2:True Choice 2 of 2:False 

  • Q14 4 Points Grading comment: Let's look at a squirrel population! 

  • Q14.1 2 Points Grading comment: A single squirrel population in Hardy-Weinberg equilibrium consists of either white (aa) or brown (AA and Aa) fur. Which equation represents the frequency of brown individuals in a population if we know that the frequency of the white allele is 0.7? Choice 1 of 5:2(0.3)(0.7) Choice 2 of 5:1- 0.7 Choice 3 of 5:(0.3)^2 + 2(0.3)(0.7) Choice 4 of 5:(0.3)^2 Choice 5 of 5:none of the choices 

  • Q14.2 2 Points Grading comment: The squirrels discussed in the previous question represent a population of squirrels on farmland in Vermont. During one summer storm, flooding kills most of the squirrels. In the following year, scientists note that almost 95% of the squirrels are now brown. As a biologist, how would you describe what has happened? Choice 1 of 4:Due to the bottleneck effect, the allele frequency of the new population is different than the original Choice 2 of 4:Stabilizing selection was caused by the differential reproductive success of brown squirrels. Choice 3 of 4:Reproductive barriers have led to a brown and white species that can no longer interbreed. Choice 4 of 4:Directional selection was caused by the differential reproductive success of brown squirrels. 

  • Q15 2 Points Grading comment: A nonsense mutation in a tumor suppressor protein associated with an inhibitory pathway is likely to be found in a cancer cell. Choice 1 of 2:True Choice 2 of 2:False

  •  

  • Q16 2 Points Grading comment: Which of the following statements is NOT consistent with Darwin’s theory of natural selection? Choice 1 of 5:Individuals in the population exhibit variations, some of which are heritable Choice 2 of 5:Factors in the environment result in some organisms having better reproductive success than others Choice 3 of 5:Individual organisms change during their lifespans to better fit their environment, and these changes are heritable Choice 4 of 5:In a stable environment, individuals that reproduce successfully are more likely than other individuals to have offspring that also reproduce successfully Choice 5 of 5:Natural selection can lead to the appearance of new species. 


  • Q17 2 Points Grading comment: Question_45.png According to the diagram what organism lacks lungs but still has jaws? Choice 1 of 5:Lamprey Choice 2 of 5:Sea Bass Choice 3 of 5:Antelope Choice 4 of 5:Bald Eagle Choice 5 of 5:Alligator 


  • Q18 2 Points Grading comment: Which of the following is an example of directional selection? Choice 1 of 4:Human birthweights are constrained to a narrow range due to the issues related to being born too small or too large Choice 2 of 4:As grasslands spread across North America, horses with longer legs were able to find more food and produce more offspring. Over time longer legs became more common among the horse populations. Choice 3 of 4:Male Komodo Dragons engage in combat to determine who will mate with the females present in their territories. Choice 4 of 4:Following a severe hurricane, the population of green anoles on an island dropped from 50,000 to 500.


  •  Q19 2 Points Grading comment: You eat a pretzel. How could a glucose molecule from the pretzel provide energy to blink your eyes? Choice 1 of 5:the glucose is digested into simpler molecules having more energy. Choice 2 of 5:the glucose reacts to become ATP (adenosine triphosphate). Choice 3 of 5:the glucose is converted into energy. Choice 4 of 5:The energy of the glucose is transferred to other molecules. Choice 5 of 5:the energy of the glucose is transferred to CO2 and H2O. 

  • Q20 2 Points Grading comment: Imagine that beak color in the Puteketeke bird is controlled by a single gene. You mate a Puteketeke homozygous for brown (pigmented) beak with a Puteketeke homozygous for ivory (unpigmented) beak and get numerous offspring, all of which have a pale, ivory-brown beak. This pattern of color expression is most likely to be an example of _. Choice 1 of 4:polygenic inheritance Choice 2 of 4:pleiotropy Choice 3 of 4:codominance Choice 4 of 4:incomplete dominance 

  • Q21 2 Points Grading comment: Picture6.png Based on these results, the flies likely but have an issue with . Choice 1 of 4:Do not breed; hybrid viability Choice 2 of 4:Do not breed; hybrid fertility Choice 3 of 4:Do breed; hybrid fertility Choice 4 of 4:Do breed; hybrid viability 

  • Q22 2 Points Grading comment: Picture5.png If a pregnancy occurs, hormones and would remain low: Choice 1 of 6:A and B Choice 2 of 6:A and C Choice 3 of 6:A and D Choice 4 of 6:B and C Choice 5 of 6:B and D Choice 6 of 6:C and D 

  • Q23 2 Points Grading comment: Whoa! A small bird landed on a tree on campus and the tree fell over! This is such a great example of correlation equaling causation! Choice 1 of 2:True Choice 2 of 2:False 

  • Q24 2 Points Grading comment: Which of these statements best illustrates the concept of interaction between and among systems in biology? Choice 1 of 4:The gene for hair color is found in your DNA as a series of A, C, T, and G nucleotides linked together by phosphodiester bonds. Choice 2 of 4:The bacteria in the rumen (stomach) of a cow make a protein that allows the cow to digest cellulose and use that plant matter as a food source. Choice 3 of 4:Foxes are closely related to dogs at the genetic level even though they may act like cats in much of their behavior! Choice 4 of 4:Water can travel through an aquaporin channel because the protein folds in a way so that it has a hydrophilic core.

  •  Q25 2 Points Grading comment: Picture8.png

  • True or False: Tiktaalik and lungfish are more closely related, have a more recent common ancestor, than mammals and lungfish. Choice 1 of 2:True Choice 2 of 2:False 

  • — need to look at image—-


  • Q26 2 Points Grading comment: A prokaryote would NOT be a good system to study which of the following? Choice 1 of 5:Evolution Choice 2 of 5:The process of copying DNA. Choice 3 of 5:How hydrophobic molecules are transported into a cell Choice 4 of 5:The effect of antibiotics on mitochondria Choice 5 of 5:The building of proteins at ribosomes 

  • Q27 2 Points Grading comment: Zane was assigned a paper to read in his biology class and determine its trustworthiness. He noted that the article contained data and graphs. He investigated if the article was peer-reviewed by unbiased third-party experts, the reputation of the researchers, and who the publisher of the article was. Which component of Zane’s assignment was the most important factor influencing him to categorize the research article as trustworthy science? Choice 1 of 4:the data and graphs in the article Choice 2 of 4:whether the article was evaluated by unbiased third-party experts Choice 3 of 4:the reputation of the researchers Choice 4 of 4:the publisher of the article 

  • Q28 2 Points Grading comment: If you see a cell with mitochondria, what else would you NOT expect to see? Choice 1 of 4:Ribosomes Choice 2 of 4:Cell membrane Choice 3 of 4:Chloroplasts. Choice 4 of 4:Actually, you might see any of these in a cell with mitochondria 

  • Q29 2 Points Grading comment: Your friend Mike has decided to try making his own beer. He combines the necessary ingredients – yeast, water, and grains to provide a food source for the yeast – and decides that the beer will be better if he stirs it regularly during fermentation. He is then disappointed when the beer is carbonated, but doesn’t contain any alcohol. What do you think happened? Choice 1 of 3:The yeast didn’t have enough glucose. Choice 2 of 3:The yeast were exposed to too much glucose. Choice 3 of 3:The yeast were exposed to too much oxygen. 

  • Q30 2 Points Grading comment: Researchers have identified a new mutation where a U is inserted where the asterisk is seen below, how many amino acids, not including the start codon, does the original mRNA code for and how many does the new sequence code for? Original: 5’ – UCUAUGCAGCGA*AGUAUCAUGUCAUGA – 3’ Mutation: 5’ – UCUAUGCAGCGAUAGUAUCAUGUCAUGA – 3’ Choice 1 of 5:Original: two, Mutation: two Choice 2 of 5:Original: six, Mutation: two Choice 3 of 5:Original: four, Mutation: six Choice 4 of 5:Original: five, Mutation: three Choice 5 of 5:Original: seven, Mutation: three 

  • Q31 2 Points Grading comment: Picture1.png In 1999, a landowner in the Bahamas started a small colony of pigs on one island. The population growth is seen in the image above. At the location of the black arrow, what is true? Choice 1 of 3:The death rate > birth rate Choice 2 of 3:The death rate < birth rate Choice 3 of 3:The death rate = birth rate 

  • Q32 2 Points Grading comment: If studying the DNA inside skin cells, you would find information about which of the following? Choice 1 of 4:height and skin color Choice 2 of 4:height, but not skin color Choice 3 of 4:skin color, but not height Choice 4 of 4:Neither skin color nor height 

  • Q33 2 Points Grading comment: As an allergy sufferer, you are curious about the timing of pollen release in the spring in North Carolina. You know that sunlight becomes more intense as we move from winter to spring and that the expression of plant hormones is changing to cause pollen release in some species. Knowing what you know, which statement is most accurate about the timing of pollen release? Choice 1 of 4:Changing light levels must result in changes in gene expression which promotes plant reproduction! Choice 2 of 4:Hatching insects chewing on the plants must stimulate plant growth and plant reproduction. Choice 3 of 4:Temperature changes result in proteins completely denaturing. Choice 4 of 4:Pollen release will probably occur later each year with aggregate temperature changes. 

  • Q34 2 Points Grading comment: Picture3.png Here you can see the wild type (normal) structure of a protein (A) and the mutant version (B). A single nucleotide mutation occurred and a different amino acid was translated in the mutant protein—the shape of the final folded protein is different. Which statement BEST describes what we see? Choice 1 of 4:The R groups on the wild type and mutant amino acids must have a different charge that changes tertiary structure. Choice 2 of 4:The change to the primary sequence of the protein causes no change to how the protein folds. Choice 3 of 4:Hydrogen bonds between the amino acids in primary structure are affected by the R groups. Choice 4 of 4:The R group interactions of the secondary structure are causing folding problems in the mutant protein. 

  • Q35 2 Points Grading comment: Evolutionary theory predicts that species are related, not independent. Four of the following examples provide support for this prediction. Which one of these examples does NOT support the claim that species are related? Choice 1 of 5:Before synthetic insulin was available, diabetics used injections of purified pig insulin to manage their disease. Choice 2 of 5:All prokaryotes and eukaryotes use DNA to carry their genetic information. Choice 3 of 5:Plants that live in desert regions typically have thickened leaf surfaces to prevent water loss. Choice 4 of 5:Ground squirrel species found on the north and south sides of the Grand Canyon are similar behaviorally, despite being very different physically. Choice 5 of 5:The pharyngeal cavity of lancelets (invertebrate chordates) and the thyroid gland of vertebrates develop similarly, and both produce iodinated proteins.

  •  Q36 2 Points Grading comment: Most mutations are harmful. Choice 1 of 2:True Choice 2 of 2:False

  • Q37 2 Points Grading comment: During breeding season, screech owls have a symbiotic relationship with blind snakes (yeah, their eyes are covered by scales so their vision is really bad!) The owl will catch the blind snake, bring it to its nest, then the snake will keep the owl’s eggs and hatchlings healthy by eating insects, arachnids, and mites. You want to measure the effect the snakes have on baby owl survival. To begin your study, you need to set up an experiment that can quantify the amount of hatchlings that survive with and without the blind snakes present. Which of the following is the independent variable? Choice 1 of 4:the amount of hatchlings that survive Choice 2 of 4:the amount of insects eaten Choice 3 of 4:the presence of blind snakes Choice 4 of 4:the presence of screech owls 

  • Q38 2 Points Grading comment: A confounding factor is a variable that provides an alternative explanation for results. Which of the following research studies is least likely to contain a confounding factor in its design? Choice 1 of 4:To evaluate the effect of the “Whole 30” diet, researchers compared weight loss between participants randomly assigned to follow the Whole 30 plan (diet) and control (no diet) groups, while controlling for average daily exercise and pre-study weight. Choice 2 of 4:Researchers were interested in exploring trends in the sexual activity of students attending U.S. universities. The researchers surveyed a random selection of 333 first year students at a small private university in Southern California Choice 3 of 4:Researchers studying early childhood brain development randomly assigned participants to experimental and control groups. Males make up 32% of the experimental group and 74% of the control group. Choice 4 of 4:Researchers tested the effectiveness of a new pesticide on 11,000 tobacco plants on a large farm in NC in which all the plants were exposed to the same amount of wind, rain, and sun. Tobacco plants in the control group (no pesticide) were tested in the fall, whereas the treatment group (pesticide) was tested the following spring. 

  • Q39 2 Points Grading comment: Alejandra is asked to make very short proteins, consisting of only 2 amino acids each and make as many variations as possible (examples: Phenylalanine-Leucine or Glycine-Glycine). She has 20 different amino acids she can use. How many different short proteins (consisting of 2 amino acids) can she make? Choice 1 of 7:4 Choice 2 of 7:20 Choice 3 of 7:40 Choice 4 of 7:60 Choice 5 of 7:400 Choice 6 of 7:8,000 Choice 7 of 7:none of the choices are correct

  •  Q40 2 Points Grading comment: 50 to 100 thousand years ago, neanderthals and ancient humans mating occurred. We can now identify 3% of the Neanderthal genome in modern day humans. This is an example of _. Choice 1 of 4:a bottleneck event Choice 2 of 4:genetic drift Choice 3 of 4:gene flow Choice 4 of 4:founders effect 

  • Q41 2 Points Grading comment: What likely caused populations of parrot fishes having different mouth shapes and sizes to become distinct species distributed on various coral reefs in the South Pacific Ocean? Choice 1 of 4:The parrot fishes were quite variable, and those whose features were best suited to the available food supply on each coral reef reproduced most successfully. Choice 2 of 4:All parrot fishes are essentially alike and there are not really many different species. Choice 3 of 4:Different foods are available on different coral reefs and for that reason, individual parrot fishes on each island gradually developed the mouth shapes they needed Choice 4 of 4:Different lines of parrot fishes developed different mouth shapes because they needed them in order to obtain the available food 

  • Q42 2 Points Grading comment: Tricky advertising! Which of the following is science as opposed to a less justified claim? Choice 1 of 4:Coca-Cola falsely claimed its Vitamin water products could promote healthy joints, reduce the risk of eye disease, and have other health benefits. Choice 2 of 4:Pom Wonderful claimed its fruit juice helped reduce the risk of medical issues such as heart disease, prostate cancer, and erectile dysfunction. Those claims were not backed by research and were ruled to be deceptive. Choice 3 of 4:Cheerios claimed the breakfast cereal could lower cholesterol. After receiving a warning letter from the FTC challenging this claim, Cheerios parent General Mills changed the label to say the cereal "can help lower cholesterol." Choice 4 of 4:Research on moderate egg consumption in two large prospective cohort studies (nearly 40,000 men and over 80,000 women) found that up to one egg per day is not associated with increased heart disease risk in healthy individuals. 

  • Q43 2 Points Grading comment: When a plant absorbs CO2 and releases O2 during photosynthesis: Choice 1 of 3:The process increases the mass of the plant. Choice 2 of 3:the process decreases the mass of the plant. Choice 3 of 3:the process does not affect the mass of the plant. 

  • Q44 2 Points Grading comment: Which of the following scenarios is NOT a prezygotic reproductive barrier? Choice 1 of 4:Dozens of species of flowers in the Appalachian mountains bloom during the first few weeks of spring. However, no interbreeding occurs due to each species relying on a different pollinator (bees, wasps, hummingbird, etc.) Choice 2 of 4:The proteins on the surface of Jaguar egg cells prevent the sperm from Leopards from binding properly. As such fertilization is unable to occur. Choice 3 of 4:Although they look similar, crows and ravens rarely interbreed due to differences in their calls. Choice 4 of 4:By removing the surface proteins on a Jaguar egg cell, researchers were able to fertilize it with sperm from a Leopard. However, the embryo died following the first few cell divisions.

  •  Q45 2 Points Grading comment: In a fictional population, 25% of individuals have blue eyes (genotype AA). Which of the following statements is true? Choice 1 of 4:Roughly 25% of people are heterozygotes Choice 2 of 4:Roughly 12.5% of people are heterozygotes Choice 3 of 4:Roughly 50% of people are heterozygotes Choice 4 of 4:Roughly 37.5% of people are heterozygotes 

  • Q46 2 Points Grading comment: results in the creation of new alleles and during _ these alleles arrange into new combinations. Choice 1 of 4:meiosis; mitosis Choice 2 of 4:meiosis; natural selection Choice 3 of 4:mutation; meiosis Choice 4 of 4:genetic drift; sexual reproduction 

  • Q47 2 Points Grading comment: Picture7.jpg Scientists are working on bringing the Ground Sloths, shown above, back from extinction. Have we learned anything from the six Jurassic Park movies? However, there is a debate about where to source the DNA. Some researchers want to use DNA from a small, isolated group of sloths, while other researchers want to use DNA from a large, interconnected group. Which of the options would be the best source to ensure high levels of genetic diversity and the survival of the newly revived sloths? Choice 1 of 4:DNA from the small isolated population, since it reduces the chance of “bad” alleles being present Choice 2 of 4:DNA from the large, interconnected population, since it will provide a higher diversity of alleles Choice 3 of 4:It doesn’t matter if it comes from a small or large population, they’re all the same species so they all have the same alleles Choice 4 of 4:It doesn’t matter if it comes from a small or large population, I want one as a pet.

  •  Q48 2 Points Grading comment: Which one of the following processes could result in the net movement of substance “X” into a cell, if substance “X” is more concentrated in the cell than in the surroundings? Choice 1 of 5:active transport Choice 2 of 5:facilitated diffusion Choice 3 of 5:diffusion Choice 4 of 5:A & B Choice 5 of 5:none above 

  • 1Q49 2 Points Grading comment: Scientists are studying a gene called ACE2. The protein encoded by this gene is used by the corona virus to enter respiratory cells. In a secondary oocyte, how many alleles are present for this gene? Choice 1 of 5:zero Choice 2 of 5:one Choice 3 of 5:two Choice 4 of 5:four Choice 5 of 5:it depends on the person because of genetic variability