CH 16: How Do Genes Work?

Molecular Biology and Gene Expression

  • Molecular Biology: The branch of biology that seeks to understand life by studying the molecules that create cells.
  • Main Question: How does gene expression (the process of converting information coded in DNA into molecules that actually do things) occur?
  • Null Alleles / Loss of Function Alleles: Alleles that do not function at all.
  • One Gene-One Enzyme Hypothesis: Proposed by George Beadle and Edward Tatum. It states that each gene specifically codes for the production of a single, unique enzyme, which in turn controls a specific step in a metabolic pathway.
  • Refinement of the Hypothesis: Adrian Srb and Norman Horowitz tested this. The hypothesis was found to be incorrect because single genes can produce multiple, different proteins.
  • Metabolic Pathways: A linked series of chemical reactions occurring within a cell, catalyzed by enzymes, that convert a starting molecule into a final product through intermediate steps.

The Genetic Code Hypothesis and RNA Intermediaries

  • The Genetic Code Hypothesis: Francis Crick proposed that the sequence of bases in DNA acted as a code. His idea was that DNA was an information storage molecule; the information it contained would need to be read and then used somehow to produce proteins. It soon became clear that DNA base sequences are not translated into the amino acid sequence of proteins directly.
  • RNA as the Intermediary: François Jacob and Jacques Monod suggested that RNA molecules link genes in the nucleus and the protein-manufacturing centers that work in the cytoplasm. The link between DNA as an information repository and proteins as cellular machines is indirect.
  • mRNA (Messenger RNA): Single-stranded molecules of RNA that carry information out of the nucleus from DNA to the site of protein synthesis in the cytoplasm.
  • RNA Polymerase: An enzyme that polymerized ribonucleotides into strands of DNA (Note: The transcript specifies "strands of DNA" on page 2, though page 3 clarifies its role in transcribing DNA for RNA).

The Central Dogma of Molecular Biology

  • mRNA Hypothesis: Proposes that mRNA is the unstable intermediate molecule carrying genetic information from DNA in the nucleus to ribosomes for protein synthesis.
  • The Central Dogma: Once the mRNA hypothesis was accepted, Francis Crick articulated a set of core principles known as the Central Dogma. It summarizes the flow of information from DNA to proteins:   - DNA→RNA→ProteinsDNA \rightarrow RNA \rightarrow Proteins
  • Flow of Information: The arrows represent the flow of information between molecules, NOT the conversion of one molecule into another.

Roles of Transcription and Translation

  • Transcription: The process of using a DNA template to make an RNA molecule that has a base sequence complementary to the DNA. DNA is transcribed for RNA by RNA polymerase. Transcription means "copying information."
  • Translation: The process of using the information in the base sequence of mRNA to synthesize proteins. Information in the messenger RNA is translated into proteins by ribosomes. Translation is the conversion of information held in the nucleotide-based language of mRNA into the amino acid-based language of proteins. When you hear "translation," think "protein synthesis."
  • The Process Overview:   - Transcription: DNA→mRNADNA \rightarrow mRNA (Information storage to Information carrier)   - Translation: mRNA→ProteinsmRNA \rightarrow Proteins (Information carrier to Active cell machinery)
  • Linking Genotypes and Phenotypes: An organism's genotype is determined by the sequence of bases in its DNA, while its phenotype is largely a product of the proteins it produces.   - DNA (genotype)→mRNA→Proteins→PhenotypeDNA \text{ (genotype)} \rightarrow mRNA \rightarrow Proteins \rightarrow \text{Phenotype}

Modifications and Exceptions to the Central Dogma

  • Non-protein Coding Genes: Many genes code for RNA molecules that do not function as mRNAs; they are transcribed from DNA but never translated into proteins. For these genes, information flow is simply DNA→RNADNA \rightarrow RNA.
  • Reverse Flow: Information sometimes flows from RNA back to DNA.
  • Reverse Transcriptase: A viral enzyme that synthesizes a DNA version of the RNA genes.

The Genetic Code and Codons

  • Genetic Code: The rules that specify the relationship between a sequence of nucleotides in DNA or RNA and the sequence of amino acids in a protein.
  • Logic of the Code:   - There are only 4 different bases in ribonucleotides (AA, UU, GG, CC).   - A two-base code could represent just 4×4=164 \times 4 = 16 different amino acids.   - A three-base code could specify 4×4×4=644 \times 4 \times 4 = 64 different amino acids.   - A three-base code, known as a triplet code, is the shortest genetic word to code for at least 20 amino acids.
  • Codon: A group of three bases that specifies a particular amino acid.
  • Reading Frame: A specific way of dividing a nucleotide sequence (DNA/RNA) into consecutive, non-overlapping triplets (codons) that define amino acids.
  • Start Codon: There is one start codon, AUGAUG. Working with nearby ribonucleotide sequences, the AUGAUG start codon signals that protein synthesis should begin at that point on the mRNA molecule.
  • Stop Codons: There are three stop codons with the sequences UAAUAA, UAGUAG, and UGAUGA. Stop codons do not code for any amino acid but signal the end of the reading frame and end the polypeptide.

Properties of the Genetic Code

  • Redundant (Degeneracy): All amino acids except methionine and tryptophan are coded for by more than one codon. Codons specifying the same amino acid are synonymous codons.
  • Unambiguous: A given codon never codes for more than one amino acid.
  • Non-overlapping: Once the ribosome locks onto the first codon, the reading frame is established, and the ribosome then reads each separate codon one after another.
  • (Nearly) Universal: With a few minor exceptions, all codons specify the same amino acids in all organisms.
  • Conservative: When several codons specify the same amino acid, the first two bases in these codons are usually identical.
  • Stability: If a change in DNA sequence leads to a change in the third position of a codon, it is less likely to alter the amino acid in the protein.

Predictive Value of the Code

  • Knowing the genetic code and central dogma allows biologists to:   - Predict the amino acid sequence encoded by a particular DNA sequence.   - Determine mRNA and DNA sequences that could code for a particular sequence of amino acids.

Types and Consequences of Mutations

  • Mutation: Any permanent change in an organism's DNA.
  • Point Mutation: A mutation that alters the sequence of one or a small number of base pairs.
  • Missense Mutations: Point mutations that change the identity of an amino acid in a protein.
  • Silent Mutation: A point mutation that does not change the amino acid sequence of the gene product.
  • Frameshift Mutations: Mutations that shift the reading frame (insertion or deletion). These almost always destroy the function of the protein.
  • Nonsense Mutation: A type of point mutation that occurs when a codon specifying an amino acid is changed by mutation to one that specifies a stop codon. This causes early termination of the polypeptide chain and results in a non-functional protein.
  • General Categories of Mutations:   - Beneficial   - Neutral   - Deleterious (harmful). Most point mutations are slightly deleterious or neutral.

Chromosome Mutations

  • Cause: Changes in chromosome number result from mistakes in moving chromosomes into daughter cells during meiosis or mitosis.
  • Chromosomal Deletion: The loss of a segment of a chromosome, leading to missing genes.
  • Chromosome Inversion: A structural rearrangement where a segment of a chromosome breaks in two places, rotates 180∘180^{\circ}, and reinserts itself, reversing the gene order.
  • Chromosome Duplication: A genetic alteration where a segment of a chromosome is copied, resulting in extra genetic material.
  • Chromosome Translocation: A genetic abnormality where a chromosome breaks and attaches to a different chromosome, or exchanges segments with another.

Questions & Discussion

  • PRACTICE 1: According to the central dogma, what is the intermediate molecule involved in the flow of information in a cell that should go in the blank? DNA→⋯→ProteinsDNA \rightarrow \dots \rightarrow Proteins   - Options: a) Ribosome, b) rRNA, c) mRNA, d) tRNA.   - Response: c) mRNA.

  • PRACTICE 2: The full process by which genotype becomes expressed as phenotype is called:   - Options: a) Transcription, b) Translation, c) DNA Replication, d) Gene expression.   - Response: d) Gene expression.

  • PRACTICE 3: The redundancy of the genetic code is a consequence of:   - Options: a) Having more codons than amino acids, b) Having four different letters (AA, CC, GG, and UU) in the codon alphabet, c) Having fewer codons than there are amino acids, d) Each codon having a single amino acid.   - Response: a) Having more codons than amino acids.

  • PRACTICE 4: A particular triplet of bases in the template strand of DNA is 5′−AGT−3′5'-AGT-3'. What would be the corresponding codon for the mRNA that is transcribed?   - Options: a) 3′−UCA−5′3'-UCA-5', b) 3′−UGA−5′3'-UGA-5', c) 5′−TCA−3′5'-TCA-3', d) 3′−ACU−5′3'-ACU-5'.   - Response: a) 3′−UCA−5′3'-UCA-5'.

  • PRACTICE 5: A particular triplet of bases in the coding sequence of DNA is AAAAAA. The anticodon on the tRNA that binds the mRNA codon is:   - Options: a) TTTTTT, b) UUAUUA, c) UUUUUU, d) AAAAAA.   - Response: c) UUUUUU.

  • PRACTICE 6: Which of the following sequences of nucleotides are possible in the template strand of DNA that would code for the polypeptide sequence Phe-Leu-lle-Val?   - Options: a) 5′−TTG−CTA−CAG−TAG−3′5'-TTG-CTA-CAG-TAG-3', b) 5′−AUG−CTG−CAG−TAT−3′5'-AUG-CTG-CAG-TAT-3', c) 3′−AAA−AAT−ATA−ACA−5′3'-AAA-AAT-ATA-ACA-5', d) 3′−AAA−GAA−TAA−CAA−5′3'-AAA-GAA-TAA-CAA-5'.   - Response: c) 3′−AAA−AAT−ATA−ACA−5′3'-AAA-AAT-ATA-ACA-5'.

  • PRACTICE 7: What amino acid sequence will be generated, based on the following mRNA codon sequence: 5′−AUG−UCU−UCG−UUA−UCC−UUG−3′5'-AUG-UCU-UCG-UUA-UCC-UUG-3'   - Options: a) Met-Arg-Glu-Arg-Glu-Arg, b) Met-Glu-Arg-Arg-Glu-Leu, c) Met-Ser-Leu-Ser-Leu-Ser, d) Met-Ser-Ser-Leu-Ser-Leu.   - Response: d) Met-Ser-Ser-Leu-Ser-Leu.

  • PRACTICE 8: Which of the following mutations, occurring just after the start codon in the mRNA is likely to have the most serious effects on the polypeptide product?   - Options: a) Deletion of one codon, b) Deletion of one nucleotide, c) Insertion of three nucleotides, d) Substitution of one nucleotide.   - Response: b) Deletion of one nucleotide.

Example Case Studies and Sequences

Example: Determining Polypeptide Sequence from DNA

  • DNA Coding Strand (5′5' to 3′3'): ATGCATACCTGTTAAATGCATACCTGTTAA
  • DNA Template Strand (3′3' to 5′5'): TACGTATGGACAATTTACGTATGGACAATT
  • Step 1 (mRNA): 5′−AUG−CAU−ACC−UGU−UAA−3′5'-AUG-CAU-ACC-UGU-UAA-3'
  • Step 2 (Identify Codon Frames): Establish triplets.
  • Step 3 (Amino Acids): N−met-His-Thr-Cys-Stop-CN-\text{met-His-Thr-Cys-Stop-C}

Visual Examples of Mutations:

  • Normal Sequence: mRNA: 5′…AUG GGU CUC UGC CAA UAA…3′5' \dots AUG \, GGU \, CUC \, UGC \, CAA \, UAA \dots 3'. Polypeptide: Met-Gly-Leu-Cys-Gln-STOP.
  • Silent Mutation: mRNA remains effectively the same in terms of output (Met-Gly-Leu-Cys-Gln-STOP).
  • Missense Mutation: mRNA: 5′…AUG GGU CCC UGC CAA UAA…3′5' \dots AUG \, GGU \, CCC \, UGC \, CAA \, UAA \dots 3'. Polypeptide: Met-Gly-Pro-Cys-Gln-STOP.
  • Nonsense Mutation: mRNA changes a codon to UAAUAA. Polypeptide: Met-STOP.
  • Frameshift (Insertion): mRNA adds a nucleotide, shifting downstream sequence. Polypeptide: Met-Gly-Leu-Arg-Ser-Ile.
  • Frameshift (Deletion): mRNA removes a nucleotide, shifting downstream sequence. Polypeptide: Met-Gly-His-Val-Ile.