Microbiology Chapter 08: Microbiology Fundamentals - Introduction to Genetics and Molecular Biology

Introduction to Genetics and the Nature of Genetic Material

  • Genetics: The study of inheritance, or heredity of living things. It explores:

    • The transmission of biological properties (traits) from parent to offspring.

    • The expression and variation of those traits.

    • The structure and function of the genetic material, specifically DNA and RNA.

    • How genetic material changes.

  • Genome: The sum total of genetic material within an organism.

    • Most genomes exist in the form of chromosomes located in the nucleus (eukaryotes) or nucleoid (prokaryotes).

    • Non-chromosomal genetic material includes plasmids (found in bacteria or protozoans) and DNA found in organelles such as mitochondria and chloroplasts of certain eukaryotes.

    • Human Genome: Composed of both mitochondrial and nuclear DNA.

    • Plant Genome: Composed of mitochondrial, nuclear, and chloroplast DNA.

    • Viral Genome: Can contain either DNA or RNA.

  • Chromosome: A discrete cellular structure composed of a neatly packaged DNA molecule.

    • Eukaryotic Chromosomes:

      • DNA is wound around histone proteins.

      • Located in the nucleus.

      • Can be diploid (in pairs) or haploid (single).

      • Appear linear in structure.

    • Bacterial Chromosomes:

      • DNA is condensed into a packet using histone-like proteins.

      • Consists of a single, circular chromosome.

      • Located in the nucleoid region.

  • Gene: The basic physical and functional unit of heredity, consisting of a segment of DNA that codes for a specific product, such as a protein or RNA.

  • Categories of Genes:

    1. Structural Genes: These code for proteins.

    2. RNA Machinery Genes: These code for the RNA used in protein production.

    3. Regulatory Genes: These control gene expression.

  • Genotype vs. Phenotype:

    • Genotype: The sum of all gene types; an organism's distinctive genetic makeup.

    • Phenotype: The expression of certain traits or observable characteristics, including structures or functions.

The DNA Code and Molecular Architecture

  • Nucleotide: The basic unit of DNA and RNA structure. Every nucleotide consists of:

    1. One Phosphate group.

    2. One Deoxyribose sugar (in DNA).

    3. One Nitrogenous base.

  • Sugar-Phosphate Linkage: Nucleotides covalently bond to one another to form a sugar-phosphate backbone for each strand.

    • Each sugar attaches to two phosphates.

    • One phosphate attaches to the number 55' (five prime) carbon, and the other attaches to the 33' (three prime) carbon.

  • Nitrogenous Bases: These attach to the sugar at the 11' position via covalent bonds.

    • Purines: Adenine (AA) and Guanine (GG).

    • Pyrimidines: Cytosine (CC) and Thymine (TT).

  • Base Pairing Rules:

    • Pairing is dictated by hydrogen bonds between the bases.

    • Adenine (AA) always pairs with Thymine (TT) in DNA (via 22 hydrogen bonds).

    • Guanine (GG) always pairs with Cytosine (CC) in both DNA and RNA (via 33 hydrogen bonds).

    • In RNA, Adenine (AA) pairs with Uracil (UU).

  • Antiparallel Arrangement: The two strands of the DNA double helix run in opposite directions. One side runs from 55' to 33', while the other runs from 33' to 55'. This is a critical factor in DNA synthesis and protein production.

  • Chemical End Groups: At each 55' end is a phosphate group, while at each 33' end is a hydroxyl (OHOH) group.

DNA Replication

  • Location: Takes place in the nucleus of eukaryotic cells and the nucleoids of prokaryotic cells.

  • Semiconservative Replication: After replication, each new DNA molecule consists of one original parent strand and one newly synthesized daughter strand.

  • Process Overview: DNA replication involves the coordinated action of approximately 3030 different enzymes. Enzymes separate the existing strands and copy them to produce two identical daughter molecules.

  • Major Enzymes and Functions:

    • Helicase: Unzips the DNA helix.

    • Primase: Synthesizes RNA primers.

    • DNA Polymerase III: Adds nucleotides to the new DNA strands and performs proofreading/repair of mismatches.

    • DNA Polymerase I: Removes RNA primers and replaces them with DNA.

    • Ligases: Move along the lagging strand to link fragments (nicks), completing synthesis and separation.

  • Leading vs. Lagging Strands:

    • Leading Strand: Synthesis is continuous; requires only one primer; no Okazaki fragments; DNA Polymerase I is not used for primer removal (since there is only one at the start).

    • Lagging Strand: Synthesis occurs in fragments (Okazaki fragments); requires many primers; involves DNA Polymerase I to remove primers; involves Ligase to join fragments.

  • Speed and Accuracy:

    • In some bacteria, nucleotides are added at a pace of 750750 bases per second at each replication fork.

    • Mistakes occur in approximately 10810^8 to 10910^9 bases, but most are corrected by the proofreading of DNA polymerase III.

The Central Dogma: Transcription and Translation

  • The Central Dogma of Biology: Describes the flow of genetic information: DNA is transcribed into RNA, which is then translated into Proteins.

  • Transcription: The master code of DNA is used to synthesize an RNA molecule.

    • Occurs in the nucleus of eukaryotes and the nucleoid of prokaryotes.

    • Uses RNA Polymerase to copy a single DNA template strand.

  • Translation: Transcribed RNA is used to produce a protein.

    • Occurs in the cytoplasm of all cells on the ribosome.

  • Exceptions to the Central Dogma:

    • RNA Viruses: Convert RNA to other RNA.

    • Retroviruses: Utilize Reverse Transcription (via a viral enzyme) to convert RNA to DNA.

  • RNA (Ribonucleic Acid) Characteristics:

    • Single-stranded molecule in a helical form.

    • Contains Uracil (UU) instead of Thymine (TT).

    • Contains Ribose sugar instead of Deoxyribose.

  • Types of RNA:

    • Messenger RNA (mRNA): Carries the message specifying the protein sequence (contains codons).

    • Transfer RNA (tRNA): Carries amino acids to the ribosome; contains anticodons complementary to mRNA codons; has characteristic hairpin loops.

    • Ribosomal RNA (rRNA): Forms the physical structure of the ribosome subunits where protein synthesis occurs.

    • Regulatory RNAs: Includes Micro RNAs (miRNA), Anti-sense RNAs, Riboswitches, and Small Interfering RNAs (siRNA).

    • Primer RNAs: Operative in replication for both bacteria and eukaryotes.

    • Ribozymes: Enzymes made of RNA that remove unneeded sequences from other RNAs.

The Process of Translation and the Genetic Code

  • Ribosome Structure:

    • Prokaryotic (Bacteria, Mitochondria, Chloroplasts): 70S70S total (made of 50S50S and 30S30S subunits).

    • Eukaryotic: 80S80S total (made of 60S60S and 40S40S subunits).

    • The Small Subunit binds to the 55' end of mRNA.

    • The Large Subunit supplies enzymes for making peptide bonds and contains the A (aminoacyl) and P (peptidyl) sites.

  • The Master Genetic Code:

    • Codon: A group of three nucleotides that dictates a single amino acid.

    • 1 Codon=3 Nucleotides=1 Amino Acid1 \text{ Codon} = 3 \text{ Nucleotides} = 1 \text{ Amino Acid}.

    • There are 6464 triplet codes and 2020 amino acids.

    • Redundancy: Several different codons can represent the same amino acid, allowing for correct insertions even if DNA mistakes occur.

    • Start Codon: Always AUG (codes for Methionine).

    • Stop Codons: UAA, UAG, and UGA. These do not code for amino acids; they signal the ribosome to stop synthesis.

  • Prokaryotic vs. Eukaryotic Transcription/Translation:

    • Prokaryotes: Can perform simultaneous transcription and translation in the cytoplasm because they lack a nucleus.

    • Eukaryotes: Transcription occurs in the nucleus; mRNA must be processed and then move to the cytoplasm for translation.

    • mRNA Processing (Eukaryotes Only):

      1. Addition of a 77-methyl guanosine cap at the 55' end.

      2. Addition of a Poly-A tail at the 33' end.

      3. Splicing: Introns (non-coding sequences) are removed, and Exons (sequences that code for protein) are joined together.

Genetic Regulation of Protein Synthesis

  • Regulation Mechanisms: Control mechanisms ensure genes are active only when needed to save energy. Examples include antisense RNAs (deactivate genes), Micro RNAs (gene silencing), and riboswitches.

  • Operons: Found only in bacteria. A coordinated set of genes regulated as a single unit.

    • Inducible Operons: Usually catabolic; induced by the substrate of the enzyme they code for (e.g., produced only when the substrate is present).

    • Repressible Operons: Usually anabolic; turned off by the product synthesized by the enzyme.

  • The Lactose (lac) Operon: Best understood inducible system.

    • Regulator: Gene coding for the repressor protein.

    • Control Locus: Contains the Promoter (recognized by RNA polymerase) and the Operator (the on/off switch).

    • Structural Locus: Three genes coding for enzymes needed to catabolize lactose.

    • Condition for Activation: The lac operon is turned on only when glucose levels are low and lactose levels are high.

Gene Transfer Strategies

  • Vertical Gene Transfer: Transmission of genetic information from parent to offspring (e.g., via binary fission in bacteria).

  • Horizontal Gene Transfer (HGT): Any transfer of DNA resulting in organisms acquiring new genes that did not come from parents.

  • Types of HGT in Bacteria:

    1. Conjugation (Direct):

      • Transfer of a plasmid or genetic material via a direct connection (pilus).

      • Gram-Negative: Involves a fertility (F') factor creating a conjugative pilus. F+F^+ cells (with plasmid) transfer to FF^- cells (without).

      • Gram-Positive: An opening is created between adjacent cells for DNA passage.

      • Resistance (R) Plasmids: Carry genes for resisting antibiotics, heavy metals, or synthesizing virulence factors (toxins, adhesion molecules).

      • Conservative Process: The donor retains a copy of the transferred genetic material.

    2. Transformation (Indirect):

      • Nonspecific acceptance of small fragments of free DNA from the environment by a competent cell.

      • Facilitated by DNA-binding proteins on the cell wall.

      • Transfection: A similar process for eukaryotic cells (yeasts, plants, mice) using special reagents/instruments, not viruses.

    3. Transduction (Indirect):

      • Transfer of DNA via a Bacteriophage (virus that infects bacteria).

      • Generalized Transduction: Random fragments of host DNA are mistakenly packaged into a phage and injected into a new recipient cell.

  • Transposons ("Jumping Genes"): Transposable elements that shift from one part of the genome to another. They can move between chromosomes and plasmids. They are involved in trait changes (colony morphology, pigmentation) and the transfer of drug resistance.

Mutations: Changes in the Genetic Code

  • Mutation: Any permanent, heritable change to the nucleotide sequence in the genome.

  • Strains:

    • Wild Type: Microorganism exhibiting natural, nonmutated characteristics.

    • Mutant Strain: Microorganism with a variance in morphology, nutrition, genetic control, or chemical resistance.

  • Causes:

    • Spontaneous Mutations: Random changes arising from replication errors.

    • Induced Mutations: Result from exposure to mutagens (physical or chemical agents).

    • Mutagens: Radiation (UV light, X-rays) or chemicals (nitrous acid).

  • Categories of Point Mutations (Single Nucleotide Changes):

    • Missense Mutation: Placement of a different amino acid; may create a faulty or nonfunctional protein, or have no significant effect.

    • Nonsense Mutation: Changes a normal codon into a stop codon; usually leads to a nonfunctional protein.

    • Silent Mutation: Alters a base but does not change the amino acid; has no effect on the protein.

    • Back Mutation: A mutated gene reverses back to its original composition.

  • Frameshift Mutation: One or more bases are inserted or deleted, shifting the reading frame of the mRNA. Nearly always results in a nonfunctional protein.

Genetic Engineering and DNA Analysis

  • Genetic Engineering: Deliberate modification of an organism's genetic material.

  • Key Enzymes:

    • Restriction Endonucleases: "Molecular scissors" that recognize and clip DNA at specific palindromes (sequences that read the same 55' to 33' on both strands).

      • Cuts can leave staggered "sticky ends" or blunt ends.

      • Restriction Fragments: Pieces of DNA produced by these enzymes.

      • RFLPs (Restriction Fragment Length Polymorphisms): Variations in cutting patterns used for genetic analysis.

    • Ligase: Seals sticky ends together into plasmids or chromosomes.

    • Reverse Transcriptase: Converts RNA into DNA to create cDNA (Complementary DNA), which is free from introns and used to synthesize eukaryotic genes.

    • DNA Polymerase: Used in PCR (Polymerase Chain Reaction) to amplify or "Xerox" many copies of a DNA template.

  • Gel Electrophoresis: Separates DNA fragments by size and charge.

    • DNA is negatively charged due to phosphate groups, so it moves toward the positive pole.

    • Larger fragments move more slowly; smaller fragments move more quickly.

  • Recombinant DNA Technology: Combining genetic material from different organisms.

    • Used to mass-produce hormones, enzymes, and vaccines.

  • Cloning Vectors: Used to transfer DNA into a cell.

    • Plasmids: Small, easy to manipulate; introduced via transformation.

    • Bacteriophages: Inject DNA via transduction.

    • Vectors often contain drug resistance genes to allow for the selection of cells that successfully harbor the plasmid.

Q&A and Practical Exercises

  • Concept Check: DNA Replication: When DNA is replicated, two brand new nucleotide strands are produced. (Answer: False - it is semiconservative; each has one old and one new strand).

  • Concept Check: RNA types: Which RNA contains hairpin loops and carries amino acids? (Answer: Transfer RNA).

  • Concept Check: Lac Operon: When is the lac operon turned on? (Answer: When glucose levels are low and lactose levels are high).

  • Concept Check: HGT: Which type involves taking up DNA from the environment? (Answer: Transformation).

  • Concept Check: Mutation Severity: Which mutation has the most devastating effect? (Answer: Frameshift mutation).

  • Practice Problem 1 (Slide 35): Sequence 5 UCCGAUGAGAUGCCCCUAACAC 35' \text{ UCCGAUGAGAUGCCCCUAACAC } 3'.

    1. How many nucleotides? 2222.

    2. How many codons? 77 with one extra CC.

    3. Start codon? AUG (5th-7th position).

    4. Stop codon? UAA.

    5. How many amino acids? 44 (AUG, AGA, UGA, GCC).

    6. Complementary sequence? 3 AGGCUACUCUACGGGGAUUGUG 53' \text{ AGGCUACUCUACGGGGAUUGUG } 5'

  • Practice Problem 2 (Slide 36-37): Sequence 5 UUA CCG AUG CCG AAC GGU GCC UAA CGC UUU 35' \text{ UUA CCG AUG CCG AAC GGU GCC UAA CGC UUU } 3'

    1. Codons: 1010.

    2. Nucleotides: 3030.

    3. First/Last Nucleotide: UU / UU.

    4. Start/Stop: AUG / UAA.

    5. Amino Acids: 55.

    6. Complement sequence: 3 AAU GGC UAC GGC UUG CCA CGG AUU GCG AAA 53' \text{ AAU GGC UAC GGC UUG CCA CGG AUU GCG AAA } 5'

  • Restriction Enzyme Calculation:

    • If a linear piece of DNA is cut once, you get 22 fragments.

    • If a circular piece of DNA is cut once, you get 11 fragment (it just opens the circle).