Epigenetics & Regulation of Gene Expression

Key Molecular Acronyms (DO NOW)

  • DNADNA → Deoxyribonucleic Acid (nuclear genome)

  • mtDNAmtDNA → Mitochondrial Deoxyribonucleic Acid (circular genome in mitochondria)

  • RNARNA → Ribonucleic Acid (single-stranded nucleic acid)

  • rRNArRNA → Ribosomal Ribonucleic Acid (structural & catalytic component of ribosomes)

  • mRNAmRNA → Messenger Ribonucleic Acid (transcript that carries genetic code to ribosome)

  • tRNA→ Transfer Ribonucleic Acid (adapter that brings amino acids during translation)

Chromatin Architecture & Histones

  • DNA length far exceeds nuclear diameter; compaction is achieved by wrapping around histone proteins.

    • 8 histone molecules (octamer) + ~146 bp DNA ⇒ nucleosome.

    • “Beads-on-a-string” nucleosome chain = chromatin.

  • Chromatin states

    • Loosely coiled ⇒ euchromatin (interphase, active genes)

    • Super-coiled ⇒ chromosomes (mitosis/meiosis, transport form)

  • Histone roles

    • Provide structural scaffold

    • Regulate gene accessibility (on/off switch via chemical tags)

Central Dogma Refresher

  • Information flow: DNAtranscriptionmRNAtranslationpolypeptideDNA \xrightarrow{\text{transcription}} mRNA \xrightarrow{\text{translation}} \text{polypeptide}

  • Example triplet conversion

    • DNA fragment: CTCACTCCCGTTGGAACTCACTCCCGTTGGAA

    • mRNA (complementary w/ U): GAGUGAGGGCAACCUUGAGUGAGGGCAACCUU

    • Codons built ⟶ amino acids (gly, ser, ala, asn in slide example)

  • “A gene encodes a protein”; expression level depends on transcription + translation efficiency.

Epigenetics – Core Definition

  • Literal: “epi” (on top of) + “genetics” → modifications on top of the genome.

  • Syllabus wording: study of phenotypic expression of genes dependent on

    • Factors controlling transcription & translation during protein synthesis

    • Products of other genes

    • Environmental inputs

  • Key insight: DNA sequence remains unchanged; expression pattern can be permanently or heritably altered.

Histone Modification (General)

  • Alters specific amino acids in histone tails → conformational change.

  • Conformation is copied during DNA replication ⇒ cell-type memory (prevents a specialised cell reverting to stem-cell state).

  • Two major chemical tags discussed: acetyl groups and methyl groups (can be mono-, di- or tri-methyl).

Histone Acetylation (Subtype of Modification)

  • Addition of an acetyl group (COCH3)(-COCH_3) to lysine residues on histone tails.

  • Consequences

    • Neutralises positive charge on lysine → weakens electrostatic attraction between histone and negatively charged DNA.

    • DNA wraps more loosely ⇒ open chromatin.

    • RNA polymerase more easily binds promoter ⇒ ↑ transcription ⇒ enhanced gene expression.

DNA Methylation & Demethylation

  • Methylation

    • Addition of methyl group to cytosine within CpGCpG dinucleotides.

    • Blocks transcription factor / RNA polymerase binding → ↓ transcription.

    • Therefore inhibits gene expression (gene silencing).

  • Demethylation

    • Enzymatic removal of these methyl marks.

    • Restores accessibility ⇒ ↑ transcription & translation ⇒ increased expression.

Environmental & Life-Stage Influences

  • Epigenetic marks accumulate naturally with

    • Age

    • Cellular differentiation

  • Modifiable by external factors

    • Severe stress (psychological or physical)

    • Nutritional status & specific dietary compounds (e.g., folate, B vitamins supplying methyl groups)

    • Toxins, pollutants, drugs (e.g., bisphenol A, nicotine)

  • Marks are reversible; some can be transmitted trans-generationally (parental environment → offspring phenotype).

Quote & Analogy

  • Geneticist Danielle Reed: “Things written in pen you can’t change (DNA). Things written in pencil you can (epigenetics).”

    • Interpretation

    • DNA sequence = permanent ink.

    • Epigenetic tags = erasable/rewritable pencil, allowing dynamic regulation without altering the script.

Examination Practice Hints

  • “Consequence of adding a methyl group”

    • State: CH3\text{CH}_3 addition at CpGCpG sites → RNA polymerase blocked ⇒ reduced transcription (2 marks).

  • “Two examples of epigenetic factors”

    • e.g., chronic stress, maternal diet, cigarette smoke, heavy metals, UV exposure (2 marks – any two).

  • “Gene B wrapped around Structure C (histone) but Gene A not”

    • Gene B tightly bound nucleosome = heterochromatin ⇒ low/no expression.

    • Gene A loosely bound or acetylated histone ⇒ euchromatin ⇒ actively transcribed.

    • Mention role of RNA polymerase accessibility & possible acetylation/methylation differences (4 marks).

Case Study Prompts (Independent Practice)

  • 1. “Lick Your Rats”

    • Phenotypic difference: high-licking vs low-licking mother rats produce pups with differing stress responses.

    • Environmental factor: maternal grooming behavior.

    • Mechanism: altered DNA methylation of glucocorticoid receptor gene in hippocampus.

  • 2. “Identical Twins”

    • Phenotypic divergence with age despite identical genome.

    • Factors: differential environments, diet, lifestyle.

    • Mechanism: accumulating discordant methylation & histone modifications.

  • 3. “Nutrition & the Epigenome”

    • Phenotype: coat color & obesity in agouti mice.

    • Factor: maternal intake of methyl-donor nutrients (folate, choline).

    • Mechanism: methylation of agouti gene promoter.

Learning Intentions & Success Criteria (Self-Checklist)

  • I can define epigenetics and distinguish it from genetic mutation.

  • I can describe:

    • Histone modification in general.

    • Specific processes: histone acetylation, histone methylation, DNA methylation, DNA demethylation.

  • I can explain real-world examples (rats, twins, nutrition) illustrating epigenetic influence on populations.

  • Linking to “Science as a Human Endeavour”: modern biotech (bisulfite sequencing, ChIP-seq) enabled these discoveries, expanding our understanding of inheritance and disease potential.