Protein Synthesis, Processing, and Regulation: The Players and Processes

Fundamental Principles of Translation

• Essential Ideas of Protein Synthesis:

  • The Reading Frame: When reading a three-digit (codon) code, the most critical issue is determining the exact point where reading begins.

  • Prokaryotic Initiation Strategy: Prokaryotic translation is driven by the direct recruitment of ribosomes to a specific site located immediately upstream from the translational start site.

  • Eukaryotic Initiation Strategy: Eukaryotic translation utilizes a scanning mechanism. The machinery binds to the mRNA and searches linearly for the start codon.

Molecular Components of the Translational Machinery

• Core Players in Translation:

  1. Messenger RNA (mRNA): Carries the genetic blueprint from DNA.

  2. Transfer RNA (tRNA) and Aminoacyl-tRNA Synthetases: tRNAs act as adaptors, while synthetases catalyze the attachment of specific amino acids to their corresponding tRNAs.

  3. Ribosomal RNA (rRNA) and Ribosomes: The multi-subunit complex where protein synthesis occurs.

  4. Protein Factors: Specialized proteins that facilitate initiation, elongation, and termination.

Comparative Structure of Prokaryotic and Eukaryotic mRNA

• Prokaryotic mRNA Characteristics:

  • Nature: Polycistronic, meaning a single mRNA molecule can encode multiple different proteins.

  • Recruitment Site: Contains the Shine-Dalgarno sequence ($AGGAGGU$) located in the $5'$ non-coding region.

  • Mechanism: The Shine-Dalgarno sequence base-pairs with a complementary sequence ($UCCUCCA$) at the $3'$ end of the $16S\,rRNA$ in the small ribosomal subunit.

  • Structure: Features a triphosphate group ($PPP$) at the $5'$ end.

• Eukaryotic mRNA Characteristics:

  • Nature: Monocistronic, meaning it encodes only a single protein.

  • $5'$ Modifications: Possesses a $5'$ cap structure ($m^7G$ or 7-methylguanosine) linked via a triphosphate bridge ($G-PPP$).

  • $3'$ Modifications: Features a Poly-A (polyadenylation) tail.

  • Scanning Site: Contains the Kozak Sequence: $gccgcc(A/G)ccAUGG$. Translation usually starts at the first $AUG$ within this consensus sequence.

  • Regions: Composed of a $5'$ untranslated region ($5'\,UTR$), a Coding Sequence (CDS) or Open Reading Frame (ORF), and a $3'$ untranslated region ($3'\,UTR$).

The Genetic Code and Open Reading Frames (ORFs)

• Codon Characteristics:

  • The code is based on triplets of nucleotides, resulting in $(4)^3 = 64$ possible combinations.

  • Redundancy/Degeneracy: Multiple codons can code for the same amino acid.

• Specific Codon Mnemonics and Identifiers:

  • Start Codon: $AUG$ (DNA equivalent: $ATG$) – "About To Go".

  • Stop Codons:

    • $UAA$: "U Are Awesome".

    • $UAG$: "U Are Great".

    • $UGA$: "U Gorgeous Ape".

  • Alternative Start/Context Codons:

    • $GTG$: "Got To Go".

    • $TTG$: "Try To Go".

• The Importance of the ORF:

  • Molecules contain multiple potential reading frames. Extreme care must be taken to select the correct ORF to ensure the intended protein is synthesized.

  • Example sequence: $aatgaatgaatggggcgttttagtagtaggggggggtgataagtaatga$

    • Frame 1: $N-E-M-G-R-F-S-S-R-G-G-...-V-M$

    • Frame 2: $M-N-E-W-G-V-L-V-V-G-G-G-D-K-...$

    • Frame 3: $...-M-N-G-A-F-...-G-G-V-I-S-N$

Regulatory Protein Factors and GTPase Dynamics

• The Role of GTPases: The most critical protein factors regulating translation are GTPases, which act as molecular switches.

• Regulation Mechanisms:

  • GAP (GTPase Activating Protein): Stimulates the hydrolysis of GTP to GDP, turning the "switch" off.

  • GEF (Guanine-nucleotide Exchange Factor): Facilitates the exchange of GDP for a new GTP, turning the "switch" back on.

• Essential Eukaryotic GTPases to Memorize:

  • Initiation: $eIF2$, $eIF5B$.

  • Elongation: $eEF1$, $eEF2$.

  • Termination: $eRF3$.

• Factor Classification:

  • Initiation Factors ($IFs$ or $eIFs$ for eukaryotes).

  • Elongation Factors ($EFs$ or $eEFs$).

  • Release Factors ($RFs$ or $eRFs$).

Ribosomal Structure and Sedimentation

• Sedimentation Coefficient ($S$): Measured in Svedberg Units, reflecting the particle's shape, mass, and density during centrifugation.

• Ribosome Types:

  • Prokaryotic Ribosome: $70S$ (composed of $50S$ and $30S$ subunits).

  • Eukaryotic Ribosome: $80S$ (composed of $60S$ and $40S$ subunits).

• Functional Sites:

  • A Site: Aminoacyl-tRNA binding site.

  • P Site: Peptidyl-tRNA binding site.

  • E Site: Exit site for deacylated tRNA.

Eukaryotic Translation Initiation: A Step-by-Step Mechanism

1. Formation of Ternary Complex: $eIF2$ bound to $GTP$ associates with the initiator methionyl-tRNA ($Met-tRNA_{i}^{Met}$).

2. Formation of $43S$ Pre-Initiation Complex: The ternary complex binds the $40S$ small ribosomal subunit along with $eIF1$, $eIF1A$, $eIF3$, and $eIF5$.

3. Activation of mRNA: The $eIF4$ complex prepares the mRNA. $eIF4E$ binds the $5'$ cap, and $eIF4G$ acts as a scaffold.

4. Formation of $48S$ Pre-Initiation Complex: The $43S$ complex is recruited to the activated mRNA. This interaction is mediated by binding between $eIF3$ (on the ribosome) and $eIF4G$ (on the mRNA).

5. Scanning: The $48S$ complex moves along the $5'\,UTR$ searching for the start codon ($AUG$).

6. GTP Hydrolysis by $eIF2$: Once the start codon is recognized, $eIF2$ (assisted by its GAP, $eIF5$) hydrolyzes its $GTP$. This causes the release of several initiation factors, clearing space for the large subunit.

7. Joining of the $60S$ Subunit: The large subunit is recruited, a process requiring $eIF5B$.

8. GTP Hydrolysis by $eIF5B$: A second hydrolysis event stabilizes the final $80S$ initiation complex, leaving the $Met-tRNA$ in the P site.

The Elongation Cycle and Peptide Synthesis

• Aminoacyl-tRNA Delivery: eEF1̑ (a GTPase) delivers the next tRNA to the A site. If the codon-anticodon match is correct, $GTP$ is hydrolyzed.

• Peptide Bond Formation: The elongating peptide chain is transferred from the tRNA in the P site to the amino acid on the tRNA in the A site.

  • Chemistry: The new amino acid is added to the Carboxyl group of the residue located at the carboxyl end of the growing peptide (Amino end → Carboxyl end).

• Translocation: $eEF2$ (a GTPase) catalyzes the movement of the ribosome one codon toward the $3'$ end of the mRNA. The tRNA formerly in the A site moves to the P site, and the uncharged tRNA in the P site moves to the E site for exit.

• Energy Requirements: Exactly $2$ $GTPs$ are hydrolyzed for every single amino acid added to the chain.

• Recycling: The recycling of $eEF1$ is mediated by a specific Guanine-nucleotide Exchange Factor ($GEF$).

Termination of Translation and Ribosomal Recycling

• Recognition of Stop Codons: When a stop codon ($UAA, UAG, UGA$) enters the A site, it is recognized by Release Factors $eRF1$ and $eRF3$.

• Polypeptide Release: $eRF1$ triggers the cleavage of the polypeptide from the tRNA in the P site.

• Energetics: $1$ additional $GTP$ is hydrolyzed by $eRF3$ during the termination process.

• Translational Re-Initiation: In eukaryotes, the mRNA circularizes to enhance efficiency. The $5'$ cap complex ($eIF4E/eIF4G$) interacts with Poly-A Binding Proteins ($PABP1$) bound to the $3'$ tail, allowing ribosomes that finish translation to easily find the start site again.

Polyribosomes and Translational Efficiency

• Polyribosomes (Polysomes): This refers to the configuration where multiple ribosomes (e.g., $5$ or more) simultaneously read the same mRNA molecule in a sequential fashion.

• Function: This arrangement allows for the simultaneous production of multiple copies of a polypeptide from a single mRNA template, maximizing protein synthesis output.

• Dynamics: Ribosomes move from the initiator codon ($AUG$) toward the stop codon ($UAG/UAA/UGA$), with growing polypeptide chains increasing in length as the ribosome nears the $3'$ end.

• Subunit Recycling: Upon reaching the stop codon, the $30S$ and $50S$ (or $40S$ and $60S$) subunits dissociate and can be recycled for new initiation rounds.