Mitotic Phosphorylation of γ-Tubulin at Ser364 Regulates Spindle Assembly

Core Mechanisms of γ-Tubulin Ring Complex (γTuRC) and Microtubule Nucleation

• Definition and Function of γTuRC:

  • Microtubules are dynamic polar filaments whose negative (minus) ends attach to microtubule-organizing centers (MTOCs) and positive (plus) ends extend into the cytoplasm.

  • The primary MTOC in animal cells is the centrosome, comprising a pair of centrioles embedded in pericentriolar material (PCM).

  • Centrosomes position at the focus of a radial microtubule array during interphase and form the spindle poles during mitosis.

  • Microtubule nucleation at centrosomes and acentrosomal sites requires the γ-tubulin ring complex (γTuRC), a macromolecular assembly with a total molecular mass of $\sim 2.2\,\text{MDa}$.

• Molecular Architecture of γTuRC:

  • Core Components: Composed of $\gamma\text{-tubulin}$ and five conserved $\gamma\text{-tubulin}$ complex proteins: GCP2, GCP3, GCP4, GCP5, and GCP6.

  • Subcomplex Structure: Two $\gamma\text{-tubulin}$ molecules bind with one GCP2 and one GCP3 to form the tetrameric $\gamma\text{-tubulin}$ small complex ($\gamma\text{TuSC}$). $\gamma\text{-tubulin}$ also forms $\gamma\text{TuSC}$-like heterotetramers with pairs of GCP4–GCP5 and GCP4–GCP6.

  • Complex Topology: Subcomplexes assemble in a defined sequential order to form an asymmetric, open spiral ring structure. Within this complex, GCPs interact laterally with adjacent GCPs, while each individual GCP binds longitudinally to a $\gamma\text{-tubulin}$ subunit.

  • Auxiliary Subunits: The complex incorporates additional structural proteins, including $\beta\text{-actin}$, MZT1, and MZT2A/B (also designated FAM128 and GCP8).

• Spatiotemporal Activation and Nucleation Mechanisms:

  • The majority of γTuRC complexes reside in the cytosol in an inactive conformation with minimal intrinsic nucleation activity.

  • Cryo-electron microscopy (cryo-EM) demonstrates that the baseline asymmetric spiral structure of γTuRC is geometry-incompatible with the 13-protofilament microtubule lattice template.

  • Nucleation activation requires a structural transition into a closed, symmetrical conformation. Activation is driven by binding to CDK5RAP2, which contains the $\gamma\text{TuRC}$-mediated nucleation activator ($\gamma\text{TuNA}$) within its conserved centrosomin motif 1 (CM1).

  • Conformational ring closure may also be facilitated cooperatively during microtubule assembly on the γTuRC template.

  • During mitosis, γTuRC drives spindle assembly via three distinct pathways: centrosome-based nucleation, chromatin-based nucleation, and microtubule-dependent amplification mediated by the augmin complex.

Identification and Evolutionary Conservation of γ-Tubulin Phosphorylation at Ser364

• Mass Spectrometry Discovery:

  • Isolation of endogenous γTuRC from asynchronous HEK293T cells using a recombinant His-FLAG-2$\times$TEV-SBP-$\gamma\text{TuNA}$ affinity matrix, followed by tryptic digestion and mass spectrometry (timsTOF Pro), identifies Ser364 as a phosphorylated residue on $\gamma\text{-tubulin}$.

• Sequence Conservation:

  • Protein sequence alignment across eukaryotic orthologs—from Saccharomyces cerevisiae to Homo sapiens—demonstrates that Ser364 is strictly conserved.

  • The amino acid sequence surrounding Ser364 matches the canonical minimal phosphorylation motif for Cyclin-dependent kinase 1 (Cdk1), defined as $[\text{Ser/Thr}]-\text{Pro}$.

• Cross-Species Homology:

  • In S. cerevisiae, the homologous site on the $\gamma\text{-tubulin}$ ortholog Tub4 is Ser360, which is phosphorylated during mitosis by Clb3-Cdk1 to modulate anaphase spindle microtubule dynamics.

  • Additional cell cycle-dependent phosphorylation sites on $\gamma\text{-tubulin}$ across species include:

    • Tyr445 (Budding Yeast): Phosphorylated during G1 phase to promote $\gamma\text{-tubulin}$-mediated microtubule assembly.

    • Ser131 (Human): Phosphorylated by SADB to regulate centriole duplication.

    • Ser385 (Human): Phosphorylated by SadB to control nuclear localization during S phase.

    • GCP6 Serine Sites (Human): Phosphorylated by Polo-like kinase 4 (Plk4) to drive centriole duplication.

Cdk1/Cyclin B-Mediated Kinase Specificity and Spatiotemporal Control

• In Vitro Phosphorylation Assays:

  • Incubation of reconstituted recombinant γTuRC with purified active Cdk1/cyclin B kinase in kinase buffer ($50\,\text{mM}$ Tris-HCl pH 7.7, $10\,\text{mM}$ $MgCl_2$, $10\,\text{mM}$ NaF, $1\,\text{mM}$ DTT, $0.1\,\text{mM}$ ATP) at $30\,^\circ\text{C}$ for $1\,\text{h}$ yields an $\sim 20\text{-fold}$ increase in phospho-Ser364 ($\text{pS364}$) peptide spectral matches (PSMs).

  • A custom rabbit polyclonal antibody generated against the phosphopeptide CVALSRK(pS)PYLPS specifically recognizes wild-type (WT) $\gamma\text{-tubulin}$ phosphorylated by Cdk1/cyclin B, but exhibits zero cross-reactivity with non-phosphorylated WT $\gamma\text{-tubulin}$ or the non-phosphorylatable S364A mutant.

• Cellular Validation of Cdk1 Inhibition:

  • Treatment of 3$\times$FLAG-AID-GCP6 knockin HEK293T cells with the selective Cdk1 inhibitor RO-3306 ($9\,\mu\text{M}$) for $16\,\text{h}$ suppresses Ser364 phosphorylation levels by $\sim 75\%$ compared to DMSO controls ($p < 0.001$).

• Cell Cycle Regulation:

  • Quantification of $\text{pS364}$ in synchronized 3$\times$FLAG-AID-GCP6 HEK293T cells demonstrates an $\sim 6\text{-fold}$ increase in Ser364 phosphorylation during mitosis (nocodazole-arrested, $0.1\,\mu\text{g/mL}$) relative to interphase (aphidicolin-arrested, $1.6\,\mu\text{g/mL}$) ($p < 0.001$).

• Spatial Compartmentalization:

  • Subcellular fractionation of metaphase-synchronized cells into cytoplasmic and spindle-enriched fractions reveals spatial asymmetry:

    • Cytoplasmic γTuRC exhibits $\sim 10\text{-fold}$ higher $\text{pS364}$ levels than spindle-associated γTuRC ($p < 0.0001$).

    • This asymmetry mirrors the compartmentalized activity of Cdk1/cyclin B, which is enzymatically active in the mitotic cytoplasm but held inactive via Wee1-mediated phosphorylation on spindle structures.

Functional Impact of Ser364 Phosphorylation on γTuRC Activity

• Reconstitution of Recombinant γTuRC:

  • Recombinant γTuRC complexes (WT, S364A, and phosphomimetic S364D) were assembled using the biGBac polycistronic insect cell system in Sf9 cells.

  • Full assembly requires 11 subunits: $\gamma\text{-tubulin}$, GCP2, GCP3, GCP4, GCP5, C-terminally TEV-TwinStrep-tagged GCP6, MZT1, MZT2B, $\beta\text{-actin}$, RUVBL1, and RUVBL2 (RUVBL1/2 act as AAA+ ATPases facilitating complex formation).

  • Sedimentation through a $5\%$–$40\%$ sucrose gradient confirms that WT, S364A, and S364D complexes display identical sedimentation profiles, peaking in fractions corresponding to $\sim 2.2\,\text{MDa}$, confirming that Ser364 mutations do not impair complex integrity or assembly.

• In Vitro Microtubule Nucleation Assays:

  • Purified γTuRCs were incubated with $15\,\mu\text{M}$ $\alpha/\beta\text{-tubulin}$ and $2\,\text{mM}$ GTP in BRB80/150 mM KCl buffer at $37\,^\circ\text{C}$ for $5\,\text{min}$.

  • WT γTuRC: Drives robust microtubule nucleation.

  • S364A γTuRC: Exhibits nucleation activity indistinguishable from WT.

  • S364D γTuRC: Demonstrates an $\sim 85\%$ reduction in microtubule-nucleating activity ($p < 0.0001$).

• In Vivo Regrowth Assays:

  • HeLa or hTERT RPE-1 cells expressing inducible myc-tagged $\gamma\text{-tubulin}$ constructs (WT, S364A, or S364D) with concurrent depletion of endogenous $\gamma\text{-tubulin}$ via 3'-UTR siRNA (5'-CGCAUCUCUUUCUCAUAUA-3') were subjected to cold-induced microtubule depolymerization ($1\,\text{h}$ on ice) followed by warm regrowth ($37\,^\circ\text{C}$ for $85\,\text{s}$).

  • S364D Mutant: Causes an $\sim 80\%$ reduction in both centrosomal and non-centrosomal microtubule regrowth ($p < 0.0001$).

  • S364A Mutant: Displays normal interphase centrosomal and non-centrosomal microtubule regrowth levels compared to WT controls.

Regulation of Spindle Assembly and Chromosome Segregation Fidelity

• Consequences of Blocking Ser364 Phosphorylation during Mitosis:

  • Inhibition of Cdk1/cyclin B via RO-3306 or persistent expression of non-phosphorylatable S364A $\gamma\text{-tubulin}$ prevents the localized inactivation of cytoplasmic γTuRC during mitosis.

  • Ectopic Cytoplasmic Regrowth: Mitotic cells expressing S364A $\gamma\text{-tubulin}$ demonstrate significantly enhanced cytoplasmic non-spindle microtubule nucleation following cold-induced depolymerization.

  • Spindle Morphological Defects: S364A-expressing mitotic cells assemble shorter bipolar spindles, exhibiting an $\sim 30\%$ reduction in spindle length ($p < 0.0001$).

  • Partitioning of Tubulin Pool: Expressing S364A reduces the proportion of total cellular $\alpha/\beta\text{-tubulin}$ recruited into the mitotic spindle structure due to competition from persistent cytoplasmic microtubules.

  • Chromosome Segregation Aberrations:

    • Control (WT-expressing or DMSO-treated) anaphase cells display low chromosomal defect rates ($7.7\%$).

    • RO-3306-treated cells exhibit anaphase defect rates of $86.1\%$ ($p < 0.0001$), characterized by high frequencies of lagging chromosomes and chromatin bridges.

    • S364A-expressing cells similarly exhibit significantly elevated rates of lagging chromosomes and chromatin bridges during anaphase ($p < 0.01$).

• Dual-Action Cytoplasmic Regulation Model:

  • Indirect Disassembly (MAP Phosphorylation): Active Cdk1/cyclin B in the cytoplasm phosphorylates microtubule-stabilizing proteins (including MAP4, ch-TOG, and Ensconsin/MAP7), inducing their detachment from tubulin polymers and promoting the breakdown of interphase microtubule networks.

  • Direct Suppression (γTuRC Phosphorylation): Active Cdk1/cyclin B directly phosphorylates $\gamma\text{-tubulin}$ at Ser364 on cytoplasmic γTuRC, blocking the initiation of new microtubule nucleation events.

  • Spindle Preservation: Spindle-bound γTuRC remains unphosphorylated because spindle-associated Cdk1/cyclin B is maintained in an inactive state by Wee1, preserving high nucleation activity locally where spindle fibers must assemble.

  • Free Tubulin Homeostasis: Suppression of cytoplasmic microtubule nucleation preserves an adequate pool of soluble $\alpha/\beta\text{-tubulin}$ heterodimers required for rapid, robust spindle assembly.

Structural Insights and AlphaFold 3 Modeling

• Structural Context:

  • Ser364 is located within a flexible, structurally variable surface loop spanning residues 361–372 on $\gamma\text{-tubulin}$ (based on PDB: 8Q62).

• AlphaFold 3 Predictions for S364-Phosphorylated γ-Tubulin:

  • Phosphorylation at Ser364 induces localized conformational adjustments within the 361–372 surface loop.

  • Phosphorylation triggers a major structural shift in the adjacent loop encompassing residues 277–288.

  • In native $\gamma\text{-tubulin}$, the 277–288 loop is fully disordered. Upon Ser364 phosphorylation, loop 277–288 transitions into a structured, short $\alpha\text{-helix}$.

• Mechanistic Impact on Ring Closure:

  • The loop spanning residues 277–288 participates in lateral $\gamma\text{-tubulin}$–$\gamma\text{-tubulin}$ interactions between adjacent $\gamma\text{TuSC}$ subcomplexes.

  • Formation of the short $\alpha\text{-helix}$ alters the steric profile of the contact interface, disrupting crucial lateral contacts.

  • Disruption of lateral interfaces prevents γTuRC from transitioning from its asymmetric, inactive conformation into the closed, symmetrical template required for microtubule nucleation.

Experimental Procedures and Methodological Workflows

• Cell Culture and Synchronization Parameters:

  • Cell Lines: HEK293T, Phoenix-AMPHO, and HeLa cultured in DMEM ($10\%$ FBS, $1\%$ penicillin-streptomycin). hTERT RPE-1 cultured in DMEM/F12 ($10\%$ FBS, $1\%$ penicillin-streptomycin).

  • Interphase Synchronization: Incubation with $1.6\,\mu\text{g/mL}$ aphidicolin for $16\,\text{h}$, washed, and released into fresh medium for $30\,\text{min}$.

  • Mitotic Synchronization (HEK293T): Treatment with $0.1\,\mu\text{g/mL}$ nocodazole for $16\,\text{h}$, washed, and released into fresh medium for $30\,\text{min}$.

  • Mitotic Synchronization (RPE-1): Treatment with $9\,\mu\text{M}$ RO-3306 for $16\,\text{h}$, washed, and released into fresh medium for $60\,\text{min}$.

  • Metaphase Arrest for Spindle Isolation: Nocodazole treatment ($0.1\,\mu\text{g/mL}$, $16\,\text{h}$) followed by release into medium containing $20\,\mu\text{M}$ MG-132 (proteasome inhibitor) and $60\,\mu\text{g/mL}$ cycloheximide (protein synthesis inhibitor) for $60\,\text{min}$.

• Genetic Engineering Workflows:

  • Tet-On Inducible Lines: hTERT RPE-1 cells infected with pRetroX-Tet-On Advanced retrovirus, selected with $0.8\,\text{mg/mL}$ G418. Subsequently infected with pRetroX-Tight-Pur-γ-tubulin-myc (WT, S364A, or S364D), selected with $10\,\mu\text{g/mL}$ puromycin.

  • CRISPR-Cas9 Gene Knockin: 3$\times$FLAG-AID tag inserted at the C-terminus of GCP6 in HEK293T cells using the PITCh microhomology-mediated integration system. Cells transfected with pX330-sgRNA (CACCGGTCGAACAGCTGCGTGATGC and AAACGCATCACGCAGCTGTTCGAC) and pN-PITCh-3$\times$FLAG-AID, selected with $10\,\mu\text{g/mL}$ puromycin, and confirmed via PCR and Western blot.

• Recombinant Protein Production (biGBac Expression System):

  • Genes cloned into pLIB vectors ($\gamma\text{-tubulin}$, GCP2–GCP6, MZT1, MZT2B, $\beta\text{-actin}$, RUVBL1, RUVBL2).

  • Assembled into pBIG1 polygene constructs via Gibson assembly, then transferred into pBIG2 vectors via PmeI restriction digestion and Gibson assembly.

  • Transformed into DH10EMBacY E. coli; blue-white selection performed on agar containing $50\,\mu\text{g/mL}$ kanamycin, $10\,\mu\text{g/mL}$ tetracycline, $7\,\mu\text{g/mL}$ gentamycin, $50\,\mu\text{g/mL}$ Bluo-Gal, and $0.1\,\text{mM}$ IPTG.

  • Bacmids isolated by isopropanol precipitation and transfected into Sf9 insect cells ($2 \times 10^6\,\text{cells/mL}$) using PEI MAX.

  • Viral supernatant harvested at $96\,\text{h}$ (V0 generation), amplified ($96\,\text{h}$, V1 generation), and used for large-scale infection ($96\,\text{h}$).

  • Cells lysed in buffer ($50\,\text{mM}$ HEPES pH 7.4, $150\,\text{mM}$ KCl, $5\,\text{mM}$ $MgCl_2$, $1\,\text{mM}$ EGTA, $1\,\text{mM}$ DTT, $0.1\,\text{mM}$ GTP, $0.2\%$ IGEPAL CA-360, protease inhibitors). Solubilized complex purified using Strep-Tactin Agarose beads and eluted with $2.5\,\text{mM}$ desthiobiotin.

• Mitotic Spindle Isolation Protocol:

  • Metaphase-arrested cells harvested and washed in PBS with $1\,\mu\text{M}$ Taxol.

  • Cells lysed in buffer ($20\,\text{mM}$ HEPES pH 7.4, $15\,\text{mM}$ $MgCl_2$, $20\,\text{mM}$ EGTA, $0.25\%$ IGEPAL, $40\,\text{mM}$ $\beta\text{-glycerophosphate}$, $5\,\mu\text{M}$ Taxol, $6\,\mu\text{g/mL}$ Latrunculin B, $0.1\,\text{mM}$ GTP, nuclease, protease inhibitors) at $34\,^\circ\text{C}$ for $20\,\text{min}$ under shaking ($1200\,\text{rpm}$).

  • Centrifuged at $4300 \times g$ for $2\,\text{min}$ at room temperature. Supernatant supplemented with $250\,\text{mM}$ NaCl represents the Cytoplasmic Fraction.

  • Pellet washed in buffer containing $5\,\mu\text{M}$ Taxol, then resuspended in ice-cold, Taxol-free lysis buffer supplemented with $250\,\text{mM}$ NaCl for $30\,\text{min}$ on ice to depolymerize spindle microtubules.

  • Centrifuged at $1100 \times g$ for $10\,\text{min}$ at $4\,^\circ\text{C}$. The resulting supernatant represents the Spindle Fraction.

  • γTuRC isolated from both fractions via anti-FLAG M2 affinity resin.

• Microtubule Regrowth and In Vitro Polymerization Assays:

  • Cellular Regrowth Quantification: Cells fixed with paraformaldehyde buffer ($60\,\text{mM}$ PIPES-KOH, $25\,\text{mM}$ HEPES pH 6.9, $10\,\text{mM}$ EGTA, $2\,\text{mM}$ $MgCl_2$, $0.5\%$ Triton X-100, $4\%$ PFA, $2\%$ sucrose). Centrosomal fluorescence intensity enclosed within a $4\text{-}\mu\text{m}$ diameter circular ROI; cytoplasmic background enclosed in an identical adjacent ROI is subtracted.

  • In Vitro Nucleation: γTuRC mixed with $15\,\mu\text{M}$ $\alpha/\beta\text{-tubulin}$ and $2\,\text{mM}$ GTP in BRB80/150 mM KCl buffer at $37\,^\circ\text{C}$ for $5\,\text{min}$. Terminated with $1\%$ glutaraldehyde, layered onto a $15\%$ glycerol cushion in BRB80/150 mM KCl, and spun onto coverslips at $100,000 \times g$ at $4\,^\circ\text{C}$ for $15\,\text{min}$. Stained with anti-$\alpha\text{-tubulin}$ Alexa Fluor 647.

• Antibody Generation:

  • Rabbits immunized with synthetic phosphopeptide CVALSRK(pS)PYLPS conjugated to keyhole limpet hemocyanin.

  • Sera passed over SulfoLink Coupling Resin conjugated to non-phosphorylated peptide CVALSRKSPYLPS for negative adsorption.

  • Flow-through purified using SulfoLink resin coupled to the phosphopeptide. Bound $\text{pS364}$ antibodies eluted with $0.1\,\text{M}$ glycine (pH 2.7) and dialyzed against PBS.