Biological Macromolecules: Nucleic Acids, Genomics, and Proteomics

Concept 5.5: Nucleic Acids Store, Transmit, and Help Express Hereditary Information

  • The Programming of Polypeptides: If the primary structure of polypeptides determines a protein’s shape, the determinant of that primary structure is a discrete unit of inheritance known as a gene.

  • Chemical Identity: Genes consist of DNADNA, which belongs to the class of compounds termed nucleic acids.

  • Polymer Construction: Nucleic acids are polymers made of monomers called nucleotides.

  • The Roles of Nucleic Acids: There are two types of nucleic acids: deoxyribonucleic acid (DNADNA) and ribonucleic acid (RNARNA). These allow living organisms to reproduce complex components between generations.

  • DNA Functions:     * Provides directions for its own replication.     * Directs RNARNA synthesis.     * Controls protein synthesis through RNARNA.

  • Gene Expression: The entire process by which DNADNA directs RNARNA synthesis and, through RNARNA, controls protein synthesis. This is summarized as:     DNARNAproteinDNA \rightarrow RNA \rightarrow \text{protein}.

  • Genetic Inheritance: DNADNA is the genetic material inherited from parents. Each chromosome contains one long DNADNA molecule, typically carrying several hundred or more genes.

  • The Information/Hardware Analogy:     * DNADNA structure encodes information that programs cell activities but is not directly involved in operations.     * DNADNA is likened to computer software; it cannot read a barcode by itself.     * Proteins are the molecular hardware—the tools that carry out biological functions.     * Example: Hemoglobin is the protein oxygen carrier in red blood cells, not the DNADNA that specifies its structure.

  • The Role of Messenger RNA (mRNA):     * A gene along a DNADNA molecule directs the synthesis of mRNAmRNA.     * mRNAmRNA interacts with protein-synthesizing machinery (ribosomes) to direct the production of a polypeptide.     * In eukaryotic cells: DNADNA resides in the nucleus, but ribosomes are in the cytoplasm (the region between the nucleus and plasma membrane). mRNAmRNA conveys instructions from the nucleus to the cytoplasm.     * In prokaryotic cells: Nuclei are absent, but mRNAmRNA still conveys messages from DNADNA to ribosomes and other equipment.

The Components of Nucleic Acids

  • Polynucleotides: Nucleic acids exist as polymers called polynucleotides.

  • Nucleotide Structure: Composed of three specific parts:     1. A five-carbon sugar (a pentose).     2. A nitrogen-containing (nitrogenous) base.     3. One to three phosphate groups.

  • Monomer vs. Polymer State: The beginning monomer used to build a polynucleotide has 33 phosphate groups, but 22 are lost during polymerization.

  • Nucleoside: The portion of a nucleotide without any phosphate groups (Base + Sugar).

  • Nitrogenous Bases:     * Rings include nitrogen atoms that take up H+H^+ from solution, thus acting as bases.     * Pyrimidines: Feature one six-membered ring of carbon and nitrogen atoms. Members include:         * Cytosine (CC)         * Thymine (TT) — found only in DNADNA.         * Uracil (UU) — found only in RNARNA.     * Purines: Larger than pyrimidines, featuring a six-membered ring fused to a five-membered ring. Members include:         * Adenine (AA)         * Guanine (GG)

  • Pentose Sugars:     * Deoxyribose: Found in DNADNA. It lacks an oxygen atom on the second carbon in the ring.     * Ribose: Found in RNARNA.     * Numbering: Carbon numbers in the sugar involve the prime symbol ('); the phosphate group attaches to the 55' carbon.

Nucleotide Polymers

  • Polymerization Process: Nucleotides link into polynucleotides via a dehydration reaction.

  • Phosphodiester Linkage: Adjacent nucleotides are joined by a phosphate group that links the sugars of two nucleotides.

  • Sugar-Phosphate Backbone: The repeating pattern of sugar-phosphate units. Nitrogenous bases are not part of the backbone.

  • Directionality: A polynucleotide has a built-in directionality refered to as 535' \rightarrow 3'.     * The 55' end has a phosphate attached to a 5 carbon5' \text{ carbon}.     * The 33' end has a hydroxyl group on a 3 carbon3' \text{ carbon}.

  • Information Encoding: Specific information is carried in the linear sequence of bases. Because genes are hundreds to thousands of nucleotides long, base sequence possibilities are effectively limitless.     * Example: Sequence 5AGGTAACTT35'-AGGTAACTT-3' has a different meaning than 5CGCTTTAAC35'-CGCTTTAAC-3'.

The Structures of DNA and RNA Molecules

  • DNA Double Helix:     * Consists of two polynucleotide “strands” winding around an imaginary axis.     * Antiparallel Arrangement: The two sugar-phosphate backbones run in opposite 535' \rightarrow 3' directions, similar to a divided highway.     * Interior/Exterior: Backbones are on the outside; nitrogenous bases are paired in the interior.     * Bonding: Hydrogen bonds between paired bases hold the strands together.

  • Base Pairing Rules in DNA:     * Adenine (AA) always pairs with Thymine (TT).     * Guanine (GG) always pairs with Cytosine (CC).     * Complementarity: The strands are predictable counterparts. If one strand is 5AGGTCCG35'-AGGTCCG-3', the other must be 3TCCAGGC53'-TCCAGGC-5'.     * This feature allows the generation of two identical copies of DNADNA for cell division.

  • RNA Structure:     * Usually exists as single strands.     * Versatility: Base pairing can occur between regions of two RNARNA molecules or within the same molecule, allowing specific 3-D3\text{-}D shapes.     * Transfer RNA (tRNA): Roughly 80 nucleotides80 \text{ nucleotides} in length; functional L-shapeL\text{-shape} resulting from base pairing of antiparallel stretches.     * Base Pairing in RNA: Adenine (AA) pairs with Uracil (UU); Thymine (TT) is absent.

Concept 5.6: Genomics and Proteomics Transform Biological Inquiry

  • Historical Context:     * 19531953: Description of DNADNA structure.     * 1970s1970s: Development of first chemical techniques for DNADNA sequencing.     * 1990early2000s1990\text{--}early 2000s: The Human Genome Project sequenced all 3 billion3 \text{ billion} bases of the human genome.

  • Technological Advances:     * Cost of sequencing 1 million1 \text{ million} bases decreased from over $5,000\$5,000 in 20012001 to less than $0.02\$0.02 in 20162016.     * Bioinformatics: The use of computer software and computational tools to analyze large data sets.

  • Analytical Approaches:     * Genomics: Analyzing large sets of genes or whole genomes of different species.     * Proteomics: Analysis of large sets of proteins and their sequences.

  • Applications of Genomics and Proteomics:     * Evolution: Identifying relationships; e.g., the hippopotamus is identified as the land mammal most closely related to whales.     * Conservation Biology: Identifying species killed illegally (e.g., tracking elephant tusk poachers).     * Paleontology: Sequencing ancient tissues from Neanderthals (HomoneanderthalensisHomo neanderthalensis).     * Medical Science: Identifying genetic bases for diseases like cancer to allow “personalized medicine.”     * Species Interactions: Characterizing plant-associated communities of fungi and bacteria to improve agriculture.

DNA and Proteins as Tape Measures of Evolution

  • Molecular Genealogy: Linear sequences of nucleotides are passed from parents to offspring, determining protein amino acid sequences. Siblings have higher similarity than unrelated individuals.

  • Species Comparison: Closely related species share a greater proportion of DNADNA and protein sequences.

  • Hemoglobin Comparisons (β polypeptide chain\beta \text{ polypeptide chain}):     * Total length: 146 amino acids146 \text{ amino acids}.     * Humans and gorillas differ by 1 amino acid1 \text{ amino acid}.     * Humans and frogs differ by 67 amino acids67 \text{ amino acids}.

  • Genome Percentage Comparisons:     * Human vs. Chimpanzee: 9598%95\text{--}98\% identical.     * Human vs. Mouse: roughly 85%85\% identical.

Problem-Solving and Scientific Skills Exercises

  • Fish Fraud Investigation:     * Pacific salmon (Oncorhynchus) vs. Farmed Atlantic salmon (Salmo salar).     * Standard Sequence for O. kisutch (Coho salmon): 5AGGCACCGCCCTAAGTCTAC35'-AGGCACCGCCCTAAGTCTAC-3'.     * Standard Sequence for O. keta (Chum salmon): 5AGGCACCGCCCTGAGCCTAC35'-AGGCACCGCCCTGAGCCTAC-3'.     * Standard Sequence for S. salar (Atlantic salmon): 5CGGCACCGCCCTAAGTCTCT35'-CGGCACCGCCCTAAGTCTCT-3'.     * Sample labeled as O. kisutch sequence: 5CGGCACCGCCCTAAGTCTCT35'-CGGCACCGCCCTAAGTCTCT-3'.     * Conclusion: The sample matches S. salar (100%100\% identity), indicating fraud.

  • Beta-globin Analysis (Human, Monkey, Gibbon):     * Researchers isolate polypeptides or sequence DNADNA to deduce amino acid order.     * Sequence data for 146 amino acids146 \text{ amino acids} is aligned to find mismatches.     * Comparison reveals whether the rhesus monkey or gibbon is more closely related based on common residues with the human sequence.

Summary of Key Biological Macromolecules

  • Carbohydrates (Concept 5.2): Monosaccharide monomers (e.g., glucose). Polysaccharides include starch (energy storage in plants), glycogen (energy storage in animals), cellulose (plant cell walls), and chitin (exoskeletons).

  • Lipids (Concept 5.3): Hydrophobic; not true polymers. Triacylglycerols (fats/oils) consist of glycerol and 33 fatty acids. Phospholipids consist of glycerol, 22 fatty acids, and a phosphate group (form bilayers). Steroids consist of 44 fused rings (e.g., cholesterol, hormones).

  • Proteins (Concept 5.4): Amino acid monomers (2020 types). Functions include catalysis (enzymes), defense, storage, transport, hormonal signaling, receptors, movement, and structural support.

  • Nucleic Acids (Concept 5.5): Nucleotide monomers. DNADNA stores hereditary info; RNARNA functions in gene expression and carrying instructions from DNADNA to ribosomes.