DNA and Chromosome Structure

Molecule Identification

• Identify the molecule presented.

• Determine its location within a cell.

DNA Building Blocks

• Name the building block of DNA: Nucleotide.

Nucleotide Components

• The nucleotide consists of three parts:

  • A nitrogenous base.

  • A deoxyribose sugar.

  • A phosphate group.

• Chemical structure:

  • Nitrogenous base (NH2, H-C, NCC=N, N=C-H)

  • Sugar ($-O-CH_2O$)

  • Phosphate ($-O-P-O$)

DNA Bases

• The four bases found in DNA are:

  • Guanine

  • Cytosine

  • Thymine

  • Adenine

DNA vs. RNA

• Identify at least two differences between DNA and RNA:

  • DNA contains deoxyribose sugar, while RNA contains ribose sugar.

  • DNA uses the base thymine, while RNA uses uracil.

Base Pairing

• Illustration of base pairing.

Bonds Between Bases

• Name of the bond that holds the nitrogen bases together: Hydrogen bond.

DNA Structure

• Sugar-phosphate backbone.

• Nitrogenous bases extend from this backbone.

Complementary Strand Completion

• Complete the complementary strand of a given DNA molecule.

Chromosome Structure

Chromosome Components

• Telomere: The end of the chromosome.

• Short arm: One arm of the chromosome.

• Centromere: The central point where the two arms meet.

• Longer arm: The other arm of the chromosome.

• Sister chromatids: Two identical copies of a single chromosome.

• Histones: Proteins around which DNA is coiled.

DNA and Chromosomes

• DNA: A double helix molecule composed of nucleotides.

• Chromosome: A molecule of DNA coiled into a dense structure with proteins (histones).

Genes

• Gene: A segment of DNA that codes for a particular protein, determining specific traits.

Human Chromosomes

• Humans have 23 pairs of chromosomes.

• Containing approximately 100,000 genes (estimated number).

Example DNA Sequence

• Example sequence: ATGAGGATCAGCCGCAAGCGGAATTGGCGACATAA

• Complementary sequence: TACTGCCTAGTCGGCGTCGCCTTAACCGCTGTATT