Week 10

Cellular Respiration ppt

Defined as the flow of electronsm, through or within a membrane, from reduced coenzymes to an external electron acceptor, ususalluy accompanied by the generation of ATP

• results in the complete oxidation of substrates to CO2

• Drastically increases the yield of ATP form that of glycolysis alone

• Takes place mostly in the mitochondria of animals

• Electrons are removed from organic substrates and transferred to coenzymes carriers, which the transfer these electrons to oxygen

• Oxygen in the terminal are torn acceptor, therefore the overall oxygen-requiring process in known as aerobic respiration

• Oxygen is reduced to water

5 stage of Aerobic respiration

• Glycolytic pathway

  • 1 glucose is cleaved forming 2 pyruvate molecules

• Pyruvate oxidation

  • Pyruvate is oxidized to acetylene coenzyme A

• The citric acid cycle

  • Oxidation of acetylene CoA to OC2

  • Stored energy in high energy reduced coenzymes

• Electron transport

  • Electrons are transferred from reduced coenzymes to oxygen, which is coupled with active transport of protons across a membrane

• Oxidative phosphorylation

  • Synthesis of ATP

Mitochondria:

• where most of the aerobic repiration occurs

• Posses their own DNA that independent of the nuclear DNA

• Found in higher numbers in tissues with a high energy demand (Skeletal muscle)

• Can replicate themselves due to increase need for ATP (endurance sports)

• Only from the Ovum. Sperm cells don;t contribute mitochondria to reproduction

• Comprised of

  • Outer membrane

    • Not a significant permeability barrier for ions and small molecules

    • Has transmembrane Chanel proteins called Porins that permit passage of siolutes with molecular weights of up to 5000

  • Inner membrane

    • Cristae are in folding of the inner membrane

      • Creates more surface area, making it 5X larger than the outer membrane

      • Allow the inner membrane to accommodate large numbers of the protein complexes needed for

        • Solute transport

        • Electron transport

        • ATP synthesis (ATP synthase)

      • Intercristal spaces

        • Provide numerous regions where protons can accumulate during the electron transport process

    • Impermeable to most solutes

    • Partitions mitochondria into 2 compartments

      • Intermembrane space

      • Mitochondrial Matrix

    • Inner boundary membrane

      • Portion of the inner membrane adjacent to the intermembrane space

• Matrix:

  • Semifluid found in the interior of the organelle

  • Contains enzymes, DNA (15,000-20,000 base pairs) and ribosomes

  • Mutation of mitochondria DNA can lead to human disease (neurodegeneration, mitochondrial myopathies, etc)

Bacteria:

• don’t have mitochondria, but may are capable of aerobic respiration, which takes place in the:

  • Cytoplasm

    • Contains the enzymes of the citric acid cycle

  • Plasma membrane

    • Contains electron transport proteins.

Citric Acid Cylce

• AKA Tricarboxylic acid cycle (TCA), or the Krebs Cycle

• Before the cycle begins, pyruvate mist pass through portions int he mitochondrial outer membrane into he inter membrane space

• Once inside this space, pyruvate is transported across the inner membrane by a specific pyruvate symport protein (co-transported with a proton)

• Once inside the mitochondrial matrix, pyruvate is concerted to Acetylene CoA by the pyruvate Dehydrogenase complex (PDH), which consists of

  • 3 different enzymes

  • 5 coenzymes

  • 2 regulatory proteins

• This reaction is known as the oxidative decarboxylation of pyruvate

• The cycle begins with the entry of acetylene CoA and its chemical reaction with oxaloacetate to form citrate

• CoA contains the B5 vitamin: pantothenic acid

  • Citrate goes from a 6-carbon compound, to a 5- carbon compound, to a 4-carbon compound

Catabolism of Non-carbohydrates

• the citric acid cycle also plays a role in catabolism of fats and proteins

• As glycogen store are nearing depletion, animalsbegi to catabolize fats

• Once fat sores are depleted, animals to catabolize proteins (starvation, marathon runners)

Catabolism of Fats

• most fat is stored as Triglycerides

• The catabolism begins with their hydrolysis to glycerol and free fatty acids

• Glycerol is channeled into the glycolytic pathway by oxidative conversions to dihydroxyacetone phosphate

• The fatty acid bonds to CoA to form fatty acrylic CoAs, which are then degraded by B oxidation

• The initial energy required in activation step of B oxidation takes place in the cytosol

• It involves the 2nd B carbon from the carboxylic acid

• The fatty acrylic CoA then enters the mitochondria

• In Bacteria, B oxidation occurs solely in the cytoplasm

Byproducts of fat catabolism

• excessive fat catabolism can deplete from CoA (there may not be enough CoA to keep up with demands for ATP synthesis

• This will lead to the incomplete oxidation of fats and therefore, the accumulation of ketone bodies

  • Acetone

  • Acetoacetate

  • B_hydroxybutyrate

    • An accumulation of These are bad for your kidneys

• The accumulation of ketone bodies is known as Ketosis

• Large quantities o ketone ill lower blood pH, results in ketoacidosis

  • Ketoacidosis is often seen in uncontrolled diabetes

Catabolism of Proteins

• Once glycogen and lipid stores are depletes, organisms will begin to catabolize proteins

• This process begins with proteolysis (hydrolysis) of te peptide bones lignin amino acids together in a polypeptide chain

• Proteolysis requires enzymes called proteases

• The end products of proteolysis are small peptides and free amino acids

• Peptides are further digested by peptidases

• Of the 20amino acids found in proteins, only 3 give use o pyruvate or citric acid cycle intermediates directly

  • Alanine

  • Aspartame

  • Glutamate

• All other amino acids require more complicated pathways, but ultimately also come citric acid cycle intermediates

Electron transport

• the TCA cycle begins with a reaction between Acetylene CoA and oxaloacetate to form citrate

• At the end of their cycles oxaloacetate is reformed

• But the time oxaloacetate is reformed, only 10% of the possible number of ATP is formed

• The energy for the remaining amount of ATP is stored in the reduced coenzymes NADH and FADH2

• The process of coenzyme reoxidation by the transfer of electrons to oxygen

• The is process is accompanied by ATP synthesis

• NADH+H+1/2O2 _>NAD+ +H2O (Yields 52.4 kcal/mol)

• FADH2 + 1/2O2 → FAD + H2O (yields 45.9 kcal/mol)

Electron Transport System (ETS)

• A multi-step process involving a series of reversible oxidizable electron carriers that function together

• The ETS contains a number or integral membrane proteins situated in the inner mitochondrial membrane of Eukaryotes and the plasma membrane of bacteria

• carriers the make up the ETS include

  • Flavoproterins (FAD)

  • Iron-suffer proteins

  • Cytochromes (also contains iron)

  • Copper-containing cytochromes

  • Coenzyme Q (ubiquinone)

    • The only non proteins component of the ETS

Energy yield of Cellular Respiration

• ~38 ATP Per glucose max

• Glycolysis alone yields:

  • 2 ATP

  • 2 Pyruvate acid

  • 2 NADH + H+

DNA and Chromosomes ppt

DNA is found in the nucleus and never leaves the nucleus

• DNA is a polymer tht consists of 2 long strands of nucleotides which are monomers

• The 2 strands twist around one another to form a twisted ladder called a Double Helix

Nucleotides:

• 5-carbon sugar (deoxyribose)

• A phosphate group

• 1 or 4 nitrogen-containing aromatic bases

  • 2 categories

    • Purines

      • Adenine

      • Guanine

    • Pyriidines

      • Thiamine

      • Cytosine

• The phosphate and sugar components creates the DNA backbone of each strand

• Nitrogen-containing bases attach to the sugar component of the backbone

• Two strands of DNA are bonded by Hydrogen bonding between their bases

  • All other bonds in DNA are covalent

• The nucleotides of each strand are oriented in opposite directions

  • Known as the “antiparallel orientation”

• Double helix creates major and minor grooves

• Regulatory proteins attach to the major grooves

• The length of DNA is measured in base pairs (bp) and sometimes in the kilobase (kb) unit

  • The human genome contains ~3 billion base pairs

• The double helix can be twisted upon itself to form a supercoil but can also exist in a non-supercoiled relaxed state

  • It supercoils during cell division

• DNA frequently transitions between he supercoiled and relaxed state, a process catalyzed by enzymes (known as Topoisomerases)

  • Topoisomerase I will break a single strand of DNA

    • The DNA rotates, the intact strand passes through the break

    • Then the break is resealed

  • Topoisomerase II uses ATP to break both strands

    • An intact portion of the DNA strand with passed through the break

    • Then the break is resealed

• After uncoiling, the 2 strands of nucleotides can separate fro one another

• Separation of the strands is needed for DNA replication and Transcription (RNA synthesis)

• DNA Transcription and Translation will be on boards

DNA packaging:

• an enormous amount fo DNA must be packed into the nucleus of a cell

• To do so, DNA is wrapped around proteins to form chromosomes

• Small amounts of additional DNA for nonessential functions are called plasmids

• once bound to these proteins, DNA is called chromatin, which appear as fibers under a light microscope

• These fibers condense during mitosis and becom recognizable chromosomes

• The proteins with the most important role in chromatin structure are call Histones

• In addition to histones, chromatin contains nonhistone proteins for enzymatic, structural and regulatory roles

• 8 Histones bond to form an Octamer

• A section of DNA wraps around an octamer creating a Nucleosome (8 histone molecules and 146 base pairs of DNA)

• Each histone has an amino acid tail That alter how tightly chromatin is packed

• The degree to which chromatin is compacted changed during inferential phases of the cell cycle

• Tightly packed chromatin (or Heterochromatin) is transcriptionally inactive

• Loosely packed chromatin or euchromatin is transcriptionally active

Histone modification:

• each histone molecule has a protruding tail that can be tagged at various locations by adding methyl, acetylene, phosphate, or other functional groups

• The combinations of these tags create a histone code

  • A histone Code

    • The histone code is read by other proteins that use them as a set of signals for modifying chromatin structure and gene activity

    • This process can either activate or repress gene expression

Chromosomes

• only visible under the light microscope when chromatin is highly condenses (during mitosis)

• The narrow part of the chromosome is called the centromere, which plays a role is separation f duplicated chromosomes

• The tips of chromosomes are called telomeres, which contains highly repetitive DNA sequences

  • Telomeres get shorter as you age

  • Cloned animals are born with shorter telomeres

• The genetic makeup of an organism is called its genotype

• A picture of one’s compliment of chromosomes is called Karyotype

• Phenotype is a organism’s observable characteristics that are attributed to its genotype

• Chromosomes contain repeating DNA sequences that do not contribute to the phenotype

Polymorphisms

• Most of our DNA is identical to the DNA of other, however there are inherited regions that can vary from person to person

• Variations in DNA sequence between individual are termed: polymorphisms

  • The spaces between genes

• Sections of DNA with repeating aromatic bases along the nucleotide chain

• The repeating code may appear as:

  • GGTTACGTTACGTTACGTTAC

• Tandem repeats can be categorized by their length:

  • Satellite DNA

  • Variable number tandem repeats (VNTRs)

  • Short tandem repeats (STRs)

    • STRS are short sequences of DNA that are repeated numerous times

    • The tetramer “gata” may appear as “gatagatagatagata”

    • The polymorphisms in STRs are due to the different number of copies of the repeat element that can occur in a population of individuals

• D7S280 is one of 30 core CODIS STR genetic loci. This DNA is found on human chromosome 7

  • The tetrameric repeat sequence of D7S280 is “Gata”

  • Different alleles of this locus have from 6-15 tandem repeats of the “gata” sequence