HS1 - L35 Cell Surface and Nuclear Hormone Receptors and Signaling Pathways and Mechanisms

Principles of Hormone-Receptor Interaction

Hormones function as chemical messengers and are categorized into super families based on their chemical nature and synthesis. These include:

  • Peptide Hormones
  • Steroid Hormones
  • Amino Acid Derivatives

Hormones induce specific biological responses within cells by interacting with specialized receptors. These interactions lead to two primary types of cellular changes based on the signaling timeline:

  • Fast Responses: Occur within seconds to minutes. These involve the alteration of protein function and cytoplasmic machinery through intracellular signaling pathways triggered by cell-surface receptors.
  • Slow Responses: Occur within minutes to hours. These involve altered gene expression involving DNA, RNA, and the eventual synthesis of new proteins to change cell behavior.

Characteristics and Requirements of a Hormone Receptor

A molecule is defined as a hormone receptor if it meets the following criteria:

  • Specificity: It must bind the hormone specifically and be able to detect it even in the presence of other closely related molecules.
  • High Affinity: It must possess high enough affinity to detect and bind the hormone at the low concentrations typically found in the blood.
  • Tissue Specificity: The receptor must be localized only on specific target tissues.
  • Saturability: There must be a limited number of binding sites, meaning the receptor response must be saturable.
  • Biological Response: The binding event must be coupled to the mediation of a specific biological response.

Hormone receptors are classified into two main types based on their cellular location:

  1. Cell Surface Receptors: Located on the plasma membrane.
  2. Intracellular Receptors: Located in the cytoplasm or the nucleus.

Cell Surface Receptors Linked to Tyrosine Kinase

Cell surface receptors are categorized into major groups based on their signaling mechanisms. One prominent group is linked to Tyrosine Kinase (TK) activity. A Tyrosine Kinase is an enzyme that transfers a phosphate group from ATPATP to a tyrosine residue on a target protein. This phosphorylation induces conformational changes that propagate the signal.

Tyrosine Kinase activity is further divided into two subgroups:

  • Intrinsic Tyrosine Kinase Activity (Growth Factor Receptors): The receptor itself contains the kinase domain. Examples include:
    • Insulin Receptor
    • IGF1IGF1 (Insulin-like Growth Factor 1) Receptor
    • Epidermal Growth Factor Receptor (EGFR)
  • Recruited Tyrosine Kinase Activity (Cytokine Receptors): The receptor does not have intrinsic kinase activity but recruits external kinases upon activation. Examples include:
    • Growth Hormone Receptor (GHR)
    • Prolactin Receptor (PRL)
    • Leptin Receptor
    • These receptors typically utilize JAK (Janus Kinase) proteins which then activate STAT (Signal Transducers and Activators of Transcription) proteins to influence the nucleus.

The Epidermal Growth Factor Receptor (EGFR) Mechanism

EGFR is a membrane receptor structured to cross the outer cell membrane. Its structure includes a hormone binding site, two cysteine-rich regions, a single trans-membrane region, and an intracellular kinase domain.

  • EGF Family: There are four family members: EGF1EGF1, EGF2EGF2, EGF3EGF3, and EGF4EGF4.
  • Mechanism of Activation: The process involves ligand-induced dimerization. Peptide ligands, encoded by specific genes and cleaved to yield active hormones, bind to the receptors. This mediates autocrine and paracrine signaling.
  • Primary Signaling Pathways:
    • Ras Pathway: Involves the recruitment of adapter proteins like GRB and the exchange factor SOS. This activates Ras (exchanging GDPGDP for GTPGTP), which then activates Raf and MEK, leading to activated transcription factors.
    • Phosphatidylinositide 3-kinase (PI 3-kinase) Pathway: Generates second messengers like phosphoinositides to affect cellular processes such as calcium (Ca2+Ca^{2+}) stores.
    • JAK-STAT Pathway: Often utilized in similar cytokine-like signaling.
  • Post-translational Modification: Signaling is regulated by the balance between Kinases (which add phosphate groups) and Phosphatases (which remove them).

G-Protein Coupled Receptors (GPCR)

GPCRs are a large family of cell surface receptors characterized by a seven-transmembrane (7-TM) domain structure consisting of seven alpha-helices that cross the membrane, connected by three extracellular and three intracellular loops.

  • G-Protein Structure: G-proteins are heterotrimeric, consisting of three subunits: α\alpha, β\beta, and γ\gamma. The β/γ\beta/\gamma subunits function as a single unit.
  • Activation Cycle:
    1. Resting State: The α\alpha subunit is associated with GDPGDP (Guanosine diphosphate).
    2. Hormone Binding: Activation by a hormone induces a conformational change in the receptor.
    3. Exchange: This induces a change in the α\alpha subunit, allowing for the exchange of GDPGDP for GTPGTP (Guanosine triphosphate).
    4. Dissociation: The α\alpha subunit is released from the β/γ\beta/\gamma complex and activates second messenger systems.
GPCR Subfamilies and Pathways

There are over 20 isoforms of α\alpha subunits, grouped into 4 main subfamilies: GsαGs\alpha, GiαGi\alpha, GqαGq\alpha, and GoαGo\alpha. Receptors are classified by the downstream enzymes they activate:

  • Adenylate Cyclase Activation (\uparrow Cyclic AMP):
    • Hormones: GnRHGnRH, Somatostatin, TRHTRH, TSHTSH, LHLH, FSHFSH, ACTHACTH, Vasopressin, Catecholamines, Glucagon, PTHPTH, PTHrPPTHrP, PGE2PGE_2, GHRHGHRH.
  • Phospholipase C (PLC) Activation (IP3,DAG,Ca2+\uparrow IP_3, \uparrow DAG, \uparrow Ca^{2+}):
    • Hormones: TRHTRH, GnRHGnRH, TSHTSH, LHLH, FSHFSH, Oxytocin, Vasopressin, Angiotensin II, Ca2+Ca^{2+}, Calcitonin, PTHPTH, PTHrPPTHrP.
Second Messenger Signaling (DAG and Ca2+Ca^{2+})

When Phospholipase C is activated, it acts on membrane lipids (PIP2PIP_2) to produce two second messengers:

  1. Diacylglycerol (DAG): Activates Protein Kinase C (PKC), which phosphorylates substrate proteins.
  2. Inositol 1,4,5-triphosphate (IP3): Binds to receptors on the Endoplasmic Reticulum, releasing stored Ca2+Ca^{2+} into the cytosol.
    • Released Ca2+Ca^{2+} activates Calmodulin and Calmodulin-activated protein kinase, further modifying protein substrates.
    • Ca2+Ca^{2+} also activates other calcium-sensitive enzymes.

Steroid and Nuclear Hormone Receptors

Steroid hormones provide a different signaling paradigm as their ligands are small lipophilic (hydrophobic) molecules.

  • Transport: Most hydrophobic steroids are bound to plasma protein carriers in the blood. Only unbound (free) hormones can diffuse through the cell membrane into the target cell.
  • Receptor Function: These receptors are encoded by a single gene and function as ligand-dependent transcription factors. They have the ability to bind directly to DNA.
  • Orphan Receptors: These are receptors identified within the family that have no known ligand.
Classification of Nuclear Receptors
  • Type I Receptors:
    • Examples: Glucocorticoid, mineralocorticoid, progesterone, estrogen, and androgen receptors.
    • Location: Typically found in the cytosol.
    • Mechanism: Binding of the ligand causes the dissociation of heat shock proteins, leading to homo-dimerization. The complex then undergoes active translocation into the nucleus to bind to Hormone Response Elements (HREs).
  • Type II Receptors:
    • Examples: Vitamin D Receptor (VDRVDR), Retinoic Acid Receptor (RARRAR), and Thyroid Hormone Receptor (TRTR).
    • Location: Retained in the nucleus regardless of ligand status.
    • Mechanism: They bind to DNA as hetero-dimers, usually with the Retinoid X Receptor (RXR). In the absence of a ligand, they are complexed with co-repressor proteins. Ligand binding causes co-repressor dissociation and recruitment of co-activators and RNA polymerase.

Structure and Anatomy of Nuclear Receptors

The nuclear receptor super family consists of proteins with highly conserved structural regions:

  • Region A/B (NH2 terminal): Contains the AF-1 (Activation Function 1) domain. It provides constitutive transcriptional activation and is the least conserved, often receptor-isoform specific.
  • Region C: The DNA Binding Domain (DBD). It is centrally conserved and contains eight cysteine residues that form Zinc Fingers. Specifically, the first zinc finger domain binds DNA via the P-box, while the second is involved in dimerization.
  • Region D: The Hinge region, containing the Nuclear Localization Signal (NLS).
  • Region E/F (COOH terminal): The Ligand Binding Domain (LBD). It contains the AF-2 (Activation Function 2) domain, which is responsible for ligand-dependent transcriptional activation and strong dimerization.

Gene Transcription and Hormone Response Elements (HRE)

Hormones alter the pattern of gene expression by binding to unique regions in the promoter of genes called HREs.

  • Promoter: The DNA region where RNA polymerase attaches to initiate transcription.
  • HRE Structure: These are usually located in the regulatory regions of the target gene (often 55' close to the core promoter). They generally consist of a 6bp hexamer core recognition motif, typically arranged as two half-sites with intervening base pairs.
Types of HRE Configurations
  • Palindromic (Pal) HRE / Inverted Repeat: Example: AGAACA...TGTTCTAGAACA...TGTTCT.
  • Direct Repeat (DR) HRE: Example: AGGTCA...AGGTCAAGGTCA...AGGTCA.
  • Inverted Palindrome (IP) HRE: Example: AGAACA...TCTTGTAGAACA...TCTTGT.
  • Monomeric HRE: A single half-site.
  • A/T HRE: Includes a 55' a/t rich sequence preceding the half-site.
Specific HRE Sequences
  • ERE (Estrogen RE): AGGTCAnnnTGACCTAGGTCAnnnTGACCT
  • GRE (Glucocorticoid RE): AGAACAnnnTGTTCTAGAACAnnnTGTTCT
  • TRE (Thyroid RE): AGGTCATGACCTAGGTCATGACCT
  • VD3RE (Vitamin D3 RE): AGGTCAnnnAGACCAAGGTCAnnnAGACCA
  • RARE (Retinoic Acid RE): AGGTCAnnnnnAGACCAAGGTCAnnnnnAGACCA