Comprehensive notes on AZOMITE DTB effects in Eimeria-challenged broilers

Abstract

  • Objective: Assess effects of a dacitic tuff breccia (DTB; AZOMITE) on performance, inflammatory and antioxidant responses in broilers mildly challenged with Eimeria spp.
  • Design: 600 one-day-old Cobb 500 male chicks randomized to 5 treatments, 10 replicates of 12 birds.
  • Treatments: UC (unchallenged control, 0% DTB), CC (challenged control, 0% DTB), and challenged groups with 0.125, 0.25, or 0.5% DTB.
  • Challenge: On day 14, CC and DTB-fed birds gavaged with mixed Eimeria spp.; UC received water.
  • Growth performance measured prechallenge (0–14 d), challenge (14–20 d), postchallenge/recovery (20–26 d).
  • GI permeability measured at 5 days postinfection (dpi).
  • Intestinal histology and nutrient digestibility (DM, CP) and ileal digestible energy (IDE) measured at 6 dpi.
  • Liver antioxidant system: glutathione peroxidase (GSH-Px) activity at 6 dpi; reduced (GSH) and oxidized (GSSG) glutathione measured at 6 and 12 dpi.
  • Data analysis: Linear mixed model with Tukey’s test (P ≤ 0.05); linear and quadratic contrasts for AZOMITE inclusion.
  • Key findings (summary): mild coccidial challenge reduced growth performance, ileal nutrient digestibility, intestinal morphology, and GI integrity; DTB at 0.125% improved antioxidant responses, CP digestibility, and growth performance relative to challenged controls; effects varied by time point and dose.

Introduction

  • Coccidiosis is an enteric disease in poultry caused by Eimeria spp., transmitted via sporulated oocysts.
  • Infection damages intestinal epithelial cells, reducing nutrient digestibility, increasing inflammation and oxidative stress, impairing growth and welfare.
  • Coccidiosis is a major risk factor for necrotic enteritis via enteric dysbiosis.
  • Conventional anticoccidials exist, but there is interest in nutritional strategies due to antibiotic concerns.
  • Mineral supplementation (including trace minerals) has been proposed to mitigate coccidiosis effects.
  • DTB (AZOMITE) is a hydrated sodium calcium aluminosilicate containing >70 minerals and trace minerals (e.g., Fe, Mg, Mn, Se, Zn, Cu) and rare earth elements (REE).
  • Rationale: DTB minerals could support antioxidant enzymes (GPx, SOD) and immune function, potentially alleviating Eimeria-induced inflammation and oxidative stress, especially during recovery.
  • Objective: Evaluate DTB’s effects on performance, antioxidant defense, apparent ileal digestibility (AID), intestinal health, and inflammation in Eimeria-challenged broilers.

Materials and Methods

  • Ethics: IACUC approval from University of Georgia.
  • Experimental design: RCBD with 5 treatments and 10 replicates of 12 birds each (600 total).
  • Treatments: UC (0% DTB), CC (0% DTB), 0.125% DTB, 0.25% DTB, 0.5% DTB.
  • Eimeria challenge: On day 14, CC and DTB-fed birds received ~12,500 E. maxima, 12,500 E. tenella, and 62,500 E. acervulina sporulated oocysts in 1 mL; UC received water. Challenge dose chosen to induce medium-low severity (Teng et al., 2020).
  • Housing and management: 50 cages (0.04 m2/bird) with ad libitum feed and water from day 1 to 26; lighting/temperature per Cobb 500 guidelines.
  • Diets: Starter (0–14 d) and Grower (14–26 d) corn–soybean meal-based diets formulated to meet/exceed Cobb 500 specs (Table 1). DTB replacements replaced ground corn at 0.125, 0.25, or 0.5% in the challenged diets. Titanium dioxide (TiO2, 0.3%) used as digestibility marker; TiO2 included in diets accordingly (Grower diet table indicates TiO2 in Grower only).
  • DTB source: AZOMITE Feed-grit (AZOMITE Mineral Products, Inc., Nephi, UT).
  • Measurements and sampling:
    • Growth performance: Body weight and feed intake measured at 14, 20, 26 d to calculate ADG, ADFI, GF; mortality recorded.
    • Gastrointestinal permeability: On day 19 (5 dpi), 1 bird per cage (10 birds/treatment) gavaged with FITC-dextran (1 mL, 2.2 mg/mL, 100 mg, MW 4,000); 2 h fasting; serum FITC-d measured (485/528 nm).
    • Gene expression: On day 20 (6 dpi), proximal jejunum and cecal tonsil collected for qRT-PCR; RNA quantified; cDNA synthesized; relative expression by 2−ΔΔCt using unchallenged DTB0% as calibrator. Target genes: Il-10, IFN-γ, Il-1β in cecal tonsil; Occludin, CLDN-1, Muc-2 in jejunum. GAPDH as control.
    • Histomorphology: Day 20, 2 cm mid-duodenum, jejunum, ileum segments fixed; H&E staining; measurements of villus height (VH) and crypt depth (CD) for 3 villi/crypts per slide; V:C ratio computed.
    • Antioxidant system: Days 20 and 26 (6 and 12 dpi), liver GPx and SOD activities; GSH and GSSG concentrations; GSH:GSSG ratio; protein quantified using BCA and BSA standard.
    • Apparent ileal digestibility (AID) and IDE: On day 20, ileal digesta collected from 4 birds per replicate (40/treatment) and pooled; TiO2 content measured per Short et al. (1996); CP, DM and IDE calculated with standard equations. AID and IDE defined as:
      <br/>AID(%)=[1NutrientDigestaNutrientDiet×TiO2DietTiO2Digesta]×100<br/><br /> \text{AID} (\%) = \left[1 - \frac{\text{NutrientDigesta}}{\text{NutrientDiet}} \times \frac{\text{TiO2Diet}}{\text{TiO2Digesta}}\right] \times 100<br />

      \text{IDE} = \text{GEDiet} - \text{GEDigesta} \times \frac{\text{TiO2Diet}}{\text{TiO2Digesta}}

      (Note: TI markers used to adjust for digesta recovery; IDE units typically kcal/kg or similar.)
  • Primer sequences (RT-qPCR): Table 2 lists primer pairs for housekeeping and target genes:
    • GAPDH: Forward AGCCATTCCTCCACCTTTGAT; Reverse AGTCCACAACACGGTTGCTGTAT
    • CLDN-1: Forward TGGAGGATGACCAGGTGAAGA; Reverse CGAGCCACTCTGTTGCCATA
    • Occludin: Forward GTTGGATGAGTCCCAGTATG; Reverse GTCGAACTCCTGCTTGTAG
    • Mucin-2: Forward CCGTTCTCTGGAGAGAGTTGTC; Reverse TCCTGGCAGCAGGAACAA
    • IL-10: Forward AGGGTGAAGTTTGAGGAAAT; Reverse GTGTAGAAGCGCAGCAT
    • IFN-γ: Forward GGAGCTCTATACTCTGAAAAACAACC; Reverse CGCTGGATTCTCAAGTCGTT
    • TNF-α: Forward CGTGGTTCGAGTCGCTGTAT; Reverse CCGTGCAGGTCGAGGTACT
    • IL-1β: Forward GCATCAAGGGCTACAAGCTC; Reverse AGATGAAGCGGGTCAGCTC
  • Statistical analysis: Normality/homogeneity checks performed; PROC MIXED (SAS v9.4), with fixed effect of treatment and random effect of block; Tukey’s test for multiple comparisons; linear (L) and quadratic (Q) contrasts for AZOMITE inclusions; significance at P ≤ 0.05; trends at 0.05 < P < 0.10.

Results

  • Growth performance (0–14 d, prechallenge)
    • ADG: no treatment differences (P = 0.383).
    • ADFI: no treatment differences (P = 0.264).
    • GF: higher in 0.125% DTB than 0.5% DTB; DTB-treated groups higher GF than CC and UC (P < 0.001).
    • GF showed a quadratic pattern with peak at 0.125% DTB (P = 0.004).
  • Growth performance (14–20 d, challenge phase)
    • ADG, ADFI, GF: UC superior to all challenged groups (P < 0.001);
    • No differences among challenged groups (0.125, 0.25, 0.5% DTB).
    • Eimeria challenge reduced ADG by ~52.5%, ADFI by ~25%, GF by ~36.9% vs UC.
  • Growth performance (20–26 d, recovery phase)
    • ADG: UC higher (trend, P = 0.057).
    • ADFI: UC higher than other treatments (P < 0.001).
    • GF: no significant differences among treatments (P = 0.172).
    • Overall (0–26 d): ADG and ADFI higher in UC than other treatments (P < 0.001); DTB affected GF with UC highest; 0.125% DTB and 0.25% DTB yielded better GF than CC (P < 0.001); quadratic trend observed (P = 0.015).
  • Mortality
    • Higher in challenged groups; mortality numbers: UC 2, CC 9, 0.125 DTB 10, 0.25 DTB 10, 0.5 DTB 6.
  • Intestinal permeability (FITC-d, 5 dpi)
    • Higher serum FITC-d in challenged groups than UC (P < 0.001).
    • No significant differences among the challenged groups (0.125, 0.25, 0.5% DTB).
  • Tight junction proteins and mucin-2 (gene expression; 20 d and 26 d)
    • 20 d (6 dpi): CLDN-1 not different; Occludin downregulated in 0.125% DTB vs UC/CC (P = 0.014); Muc-2 downregulated in 0.125%, 0.25%, 0.5% DTB vs UC (P < 0.001).
    • 26 d (12 dpi): CLDN-1 not different; Occludin not different; Muc-2 downregulated in 0.25% and 0.5% DTB vs UC (P = 0.001); linear downward trends with increasing DTB for CLDN-1 (P = 0.017) and Muc-2 (P = 0.011).
  • Antioxidant system and GSH-related measures
    • SOD activity: no differences at 20 d (P = 0.742).
    • GPx activity: increased in challenged groups, especially 0.125% DTB (P < 0.001).
    • GSH concentration: higher in UC than others at 20 d (P < 0.001); DTB inclusion associated with lower GSH (quadratic/linear trends) at 20 d.
    • GSSG concentration: not significantly different at 20 d (P = 0.234); tendency for DTB level to affect GSSG (linear, P = 0.060).
    • GSH:GSSG ratio: higher in UC at 20 d (not explicitly stated as significant); at 26 d, DTB doses reduced GSH:GSSG in a pattern consistent with lower GSH and variable GSSG (P = 0.110).
  • Liver glutathione status (26 d)
    • GSH concentration higher in 0.125% DTB than CC; UC and 0.125% DTB higher than 0.25% and 0.5% DTB (P = 0.005).
    • GSSG and GSH:GSSG not significantly different at 26 d (P = 0.783 and 0.110, respectively).
  • Inflammation-related gene expression (20 d)
    • INF-γ trend (P = 0.070) and IL-10 (P = 0.038) upregulated in all challenged treatments vs UC, indicating immune activation due to Eimeria.
    • IL-1β upregulated in 0.125% DTB and 0.5% DTB vs UC (P < 0.001); IL-1β higher in 0.125% DTB than CC and 0.25% DTB (P = 0.035).
    • TNF-α no treatment differences (P = 0.830).
  • Intestinal morphology and nutrient digestibility (20 d, 6 dpi)
    • Duodenum: CD higher in CC than 0.25% DTB; UC had lowest CD; VH and V:C highest in UC (P < 0.001).
    • Jejunum: VH highest in UC; CD similar across treatments; V:C highest in UC (P < 0.001).
    • Ileum: No differences in VH, CD, or V:C (P > 0.05).
    • CP AID: UC highest; 0.125% DTB higher than CC and 0.5% DTB (P < 0.001).
    • DM AID: UC highest; no difference among challenged groups (P < 0.001).
    • IDE: UC highest; challenged groups substantially lower (P < 0.001).
    • CP AID showed a quadratic trend with maximum at 0.125% DTB (P = 0.097).
  • Interpretation and context
    • The Eimeria challenge produced expected declines in growth, nutrient absorption, and intestinal integrity.
    • DTB at 0.125% provided notable benefits: enhanced GPx activity during challenge, improved CP digestibility, and improved GF relative to challenged controls.
    • Higher DTB levels (0.25% and 0.5%) did not consistently improve outcomes and in some cases reduced antioxidant/immune metrics and digestibility relative to 0.125% DTB; this suggests a potential optimal window around 0.125% under these challenge conditions.
    • The antioxidant status improvements with DTB may be linked to trace minerals (Se, Mn, Cu) that serve as cofactors for GPx and SOD, and possibly to REEs, which could modulate immune function and gut health.
    • Differences with previous work (e.g., White et al., 2022) indicate the effect of DTB is context-dependent, varying with stressors such as heat vs. parasitic challenge.
  • Conclusions
    • Under a mild Eimeria challenge, 0.125% DTB showed potential to modestly improve antioxidant responses (GPx), CP ileal digestibility, and growth performance metrics (GF) during the postchallenge period.
    • Higher DTB inclusions did not confer the same level of benefit and may downregulate certain barrier-related and antioxidant markers.
    • Overall, DTB at a low inclusion rate (0.125%) merits further investigation for use as a nutritional strategy to mitigate coccidial stress in broilers, with emphasis on dose optimization and interaction with specific Eimeria challenges.

Tables and Figures (Referenced in text)

  • Table 1: Diet formulation and calculated/analysed nutrient composition for Starter (0–14 d) and Grower (14–26 d) diets with DTB inclusions and TiO2 as marker.
  • Table 2: Primer sequences used for RT-qPCR analysis (GAPDH, CLDN-1, Occludin, Muc-2, IL-10, IFN-γ, TNF-α, IL-1β).
  • Table 3: Growth performance data (ADG, ADFI, GF) across the three phases and overall, with linear and quadratic contrasts for AZOMITE inclusion.
  • Table 4: Measurements of permeability (FITC-d), antioxidant enzymes (SOD, GPx) and glutathione status (GSH, GSSG, GSH:GSSG), and tight junction gene expression (CLDN-1, Occludin, Muc-2) at 20 and 26 days.
  • Table 5: Intestinal histomorphology (VH, CD, V:C) across duodenum, jejunum, ileum, along with CP DM IDE digestibility, and inflammatory gene expression (IFN-γ, IL-1β, IL-10, TNF-α) at 20 days.
  • Notable equations for digestibility:

    \text{AID} (\%) = \left[1 - \frac{\text{NutrientDigesta}}{\text{NutrientDiet}} \times \frac{\text{TiO2Diet}}{\text{TiO2Digesta}}\right] \times 100
    <br/><br />
    \text{IDE} = \text{GEDiet} - \text{GEDigesta} \times \frac{\text{TiO2Diet}}{\text{TiO2Digesta}}
    $$
  • Abbreviations:
    • UC: Unchallenged control; CC: Challenged control; DTB: Dacitic tuff breccia; ADG: Average daily gain; ADFI: Average daily feed intake; GF: Gain:feed ratio; IDE: Ileal digestible energy; AID: Apparent ileal digestibility; CP: Crude protein; DM: Dry matter; GPx: Glutathione peroxidase; SOD: Superoxide dismutase; GSH: Reduced glutathione; GSSG: Oxidized glutathione; REE: Rare earth elements; TiO2: Titanium dioxide marker.
  • Overall takeaway: Low-dose DTB (0.125%) may help mitigate some negative effects of a mild Eimeria challenge in broilers by supporting antioxidant defenses and nutrient digestibility, though effects are dose-dependent and context-specific.

Key takeaways for exam preparation

  • Experimental design: 600 chicks; 5 treatments; 14–26 d trial with Eimeria challenge on day 14; DTB included at 0.125, 0.25, 0.5%; TiO2 as digestibility marker.
  • Primary outcomes: Growth performance, intestinal permeability, tight junction and mucin gene expression, antioxidant status (GPx, SOD, GSH/GSSG), inflammation markers (IL-10, IL-1β, IFN-γ, TNF-α), intestinal morphology (VH, CD, V:C), AID of CP and IDE.
  • Important results: 0.125% DTB improved GPx activity during challenge and CP AID; 0.125% DTB produced the most favorable balance between antioxidant response and growth among DTB doses; higher DTB levels did not consistently improve outcomes.
  • Formulas to remember:
    • AID (%) = [1 - (NutrientDigesta / NutrientDiet) × (TiO2Diet / TiO2Digesta)] × 100
    • IDE = GEDiet − GEDigesta × (TiO2Diet / TiO2Digesta)
  • Implications: DTB could be a potential nutritional strategy to counteract oxidative stress and support nutrient utilization during coccidial challenge, with a clear dose-dependent response; more research needed to optimize dose and understand mechanisms, especially regarding gut barrier function and immune modulation under various stressors.