MED3LAB Advanced Biochemistry and Medical Biology Laboratory Course - Principles in Molecular Biology

MED3LAB Useful Resources

  • Textbooks:

    • Gene Cloning: Principles and Applications (available as an e-book, specifically chapters 3, 8 & 9)

    • Biochemistry Laboratory (Modern theory and techniques) Second Edition Boyer R, specifically chapters 9, 10 & 11

    • Any favorite biochemistry textbooks.

  • Websites:

    • NCBI: www.ncbi.nlm.nih.gov

    • ORF: www.ncbi.nlm.nih.gov/projects/gorf

    • Restriction mapping: www.restrictionmapper.org

    • Vector database: www.addgene.org/vector-database

  • YouTube: Great videos for all of this!

Prior Knowledge

  • Assumed prior understanding of basic principles in molecular biology:

    • The composition and structure of DNA and RNA

    • Transcription and translation

    • The genetic code

    • Open reading frames (ORFs)

    • DNA synthesis and amplification

Central Dogma of Molecular Biology

  • How does information flow between DNA, RNA, and protein?

  • What is not possible and why?

  • How should the central dogma diagram look?

DNA

  • DNA is made of repeating nucleotide units.

  • DNA nucleotides consist of:

    • Phosphate group

    • Deoxyribose sugar

    • Nitrogenous base

  • Four types of nucleotides differing by their nitrogenous base:

    • Adenine (A)

    • Guanine (G)

    • Cytosine (C)

    • Thymine (T)

  • Purines: Adenine, Guanine

  • Pyrimidines: Cytosine, Thymine

DNA Structure

  • DNA strands run antiparallel to each other.

  • Nitrogen bases have complementary pairing.

  • Held together by hydrogen bonds.

RNA vs DNA

  • RNA contains ribose sugar, while DNA contains deoxyribose sugar.

  • Detailed chemical structures of ribonucleotides and deoxyribonucleotides are shown.

RNA

  • RNA nucleotides consist of:

    • Phosphate group

    • Ribose sugar

    • Nitrogenous base

  • Four types of nucleotides:

    • Adenine (A)

    • Guanine (G)

    • Cytosine (C)

    • Uracil (U)

  • Purines: Adenine, Guanine

  • Pyrimidines: Cytosine, Uracil

Uracil vs Thymine

  • Why is uracil replaced by thymine in DNA?

The Genetic Code

  • Triplet code: Each codon consists of three nucleotides.

  • Degenerate: More than one codon can specify the same amino acid.

  • Codons for the same amino acid are similar; the third base varies most often.

Reading Frames

  • In double-stranded DNA (dsDNA), there are six potential reading frames.

  • Every mRNA has three potential reading frames.

  • There are only three possible reading frames in each strand because after three nucleotides, the codons repeat.

Correct Reading Frame

  • Translation usually begins with an AUG codon which encodes methionine (start codon).

  • Three codons (UAA, UAG, UGA) don't encode any amino acid and halt translation (stop codons or termination codons).

  • A continuous stretch of codons without a stop codon is called an open reading frame (ORF).

  • A complete ORF is bounded by a start and stop codon.

  • In eukaryotes, often the longest ORF is used.

  • Selection of the correct reading frame relies on features upstream of the start codon (RBS, Kozak sequence, Shine-Dalgarno sequence).

Experimental Workflow

  • Cloning:

    • Amplification of GFP insert by PCR.

    • Ligation of insert into plasmid vector.

    • Propagation of plasmid.

    • Purification of plasmid.

    • Restriction analysis.

  • Protein Expression:

    • Induction of GFP protein expression in bacteria.

    • Protein purification.

    • Verification by SDS-PAGE.

    • Verification by Western blotting.

Learning Objectives

  • Describe gene cloning and the purpose of cloning vectors.

  • Explain the steps involved in gene cloning.

  • Explain the concepts of restriction enzyme digestion:

    • In the context of cloning fragments into a specific plasmid.

    • In designing primers to allow cloning of an amplified DNA fragment.

  • Develop a simple cloning strategy for protein expression

Gene Cloning

  • Cloning involves taking a piece of DNA from the organism where it naturally occurs and transferring into a host organism.

Requirements for Cloning

  • DNA cloning is a technique for replication of DNA fragments

  • Vector is required to carry the DNA fragment of interest into the host cell.

  • The vector ensures that it is retained in the cell and passed onto daughter cells

Reasons for Cloning

  • cDNA libraries

  • Gene regulation

  • Synthesis of transcripts

  • Protein Expression

  • Site-directed mutagenesis

  • Genome editing

Methods of Cloning

  • Restriction enzyme + ligase

  • TA Cloning

  • Blunt End

  • Ligation independent cloning

  • Artificial synthesis

Steps Involved in Cloning

  • Foreign DNA (DNA Insert) and Cloning Vector are digested with Restriction Enzymes creating Sticky ends

  • DNA Ligase then joins the DNA Insert into the Plasmid

  • The Plasmid is then transferred into a Host Bacteria

  • Bacteria may take up plasmid with or without the insert, or may not take up plasmid at all

  • Blue/White screening allows to differentiate between Bacteria with the insert or without

    • Blue colonies - have plasmids without insert. Bacterial genome is missing the lacZ gene.

    • White colonies - have plasmids with the foreign insert.

Sources of DNA

  • Genomic DNA: DNA extracted from cells and purified

  • cDNA: Produced by reverse transcription of isolated mRNA

  • Synthetic DNA: Artificially synthesised using specific equipment

  • Amplified DNA: Generated using Polymerase Chain Reaction

Cloning Vectors

  • The purpose of the vector is to carry and maintain the foreign gene in the host cell. The vector can be replicated and passed onto new cells during cell division.

  • Different types of vectors:

    • Plasmids

    • Phagemids

    • Cosmids

    • Artificial Chromosomes (YACs, BACs)

  • All vectors share common characteristics that make them amenable to gene cloning

Cloning Strategy for Protein Expression

  1. Identify region to be amplified

  2. Select expression vector

  3. Identify enzymes that will be used for cloning

  4. Design forward and reverse primers with overhangs for cloning

  5. Check the final reading frame to ensure that translation is correct

  6. Optimise primer design if required (TmT_m, Complementarity)

Cloning example

  • Designing primers to clone a cDNA into the pLAW44 bacterial expression vector

  • The resulting construct should encode the full-length protein

  • This protein is not expressed with a fusion tag

  • Identifying the region to be amplified

Primer Design for Cloning

Amplify Region

  • Identify regions for amplification on both strands of DNA.

  • Highlight annealing sites for forward and reverse primers.

  • Write the complementary 'primer' sequences.

  • DNA sequences are always written and documented 5’ → 3’

    • Forward primer binds to the NON-CODING strand. Therefore it must be COMPLIMENTARY to the non-coding strand. This makes it the SAME as the CODING strand!

    • Reverse primer binds to the CODING strand therefore it must look like the non-coding strand.

Restriction Enzyme Sites

  • Add RE recognition sites to the primer.

  • Add extra nucleotides to help with digestion (different for each enzyme).

  • One way to approach this is to pretend the RE sites are already present in the sequence.

  • In this example, BamHI (GGATCC) and HindIII (AAGCTT) are used.

Final PCR product

  • The overhanging regions on the primer do not have any complimentary regions in the original template.

  • The overhanging regions do form a part of the final PCR sequence however

  • Like all DNA sequences, the final PCR product should be reported as the coding strand (5’ → 3’)

  • Final primer sequences:

    • Forward: 5’ TTGGATCCATGGAAGATGCTTTGGATG 3’

    • Reverse: 5’ TTAAGCTTTCACAAATAGACATCG 3’

Primer Binding

  • How to find where primers bind in a sequence:

    • For the forward primer: Look for the same sequence in the coding strand

    • For the reverse primer: use the ‘reverse complement’ and look for the same sequence in the coding strand. Use https://www.bioinformatics.org/sms/rev_comp.html

Vectors

  • Select the expression vector pLAW44

  • Select enzymes that will be used for cloning

    • What restriction enzyme sites are available in the vector?

    • What restriction enzyme sites already exist in the sequence?

    • Do not use RE sites that appear in your gene!

    • We will use Bam HI (GGATCC) Hind III (AAGCTT)

Checking the Reading Frame

Enzymes

  • Digest with Bam HI (GGATCC) and Hind III (AAGCTT)

What next?

  • Attend the practical class on your specifically allocated day (Thursday or Friday)

  • Complete the associated LMS assessment module in Week 2 tab

  • Based on the provided resources and class notes (week 1-2 lectures and workshop 1 worksheet)

  • The LMS assessment module will be open on Friday 14 March at 5 pm, following the lab class and is due on Monday 17 March, 7.00 pm for everyone.

  • The settings for this quiz have been set to one attempt only

  • You can change answers as many times as you like before submission, however you can only submit your final answers once.

  • Note that any open assessments will be submitted automatically when the quiz closes.