MED3LAB Advanced Biochemistry and Medical Biology Laboratory Course - Principles in Molecular Biology
MED3LAB Useful Resources
Textbooks:
Gene Cloning: Principles and Applications (available as an e-book, specifically chapters 3, 8 & 9)
Biochemistry Laboratory (Modern theory and techniques) Second Edition Boyer R, specifically chapters 9, 10 & 11
Any favorite biochemistry textbooks.
Websites:
NCBI: www.ncbi.nlm.nih.gov
ORF: www.ncbi.nlm.nih.gov/projects/gorf
Restriction mapping: www.restrictionmapper.org
Vector database: www.addgene.org/vector-database
YouTube: Great videos for all of this!
Prior Knowledge
Assumed prior understanding of basic principles in molecular biology:
The composition and structure of DNA and RNA
Transcription and translation
The genetic code
Open reading frames (ORFs)
DNA synthesis and amplification
Central Dogma of Molecular Biology
How does information flow between DNA, RNA, and protein?
What is not possible and why?
How should the central dogma diagram look?
DNA
DNA is made of repeating nucleotide units.
DNA nucleotides consist of:
Phosphate group
Deoxyribose sugar
Nitrogenous base
Four types of nucleotides differing by their nitrogenous base:
Adenine (A)
Guanine (G)
Cytosine (C)
Thymine (T)
Purines: Adenine, Guanine
Pyrimidines: Cytosine, Thymine
DNA Structure
DNA strands run antiparallel to each other.
Nitrogen bases have complementary pairing.
Held together by hydrogen bonds.
RNA vs DNA
RNA contains ribose sugar, while DNA contains deoxyribose sugar.
Detailed chemical structures of ribonucleotides and deoxyribonucleotides are shown.
RNA
RNA nucleotides consist of:
Phosphate group
Ribose sugar
Nitrogenous base
Four types of nucleotides:
Adenine (A)
Guanine (G)
Cytosine (C)
Uracil (U)
Purines: Adenine, Guanine
Pyrimidines: Cytosine, Uracil
Uracil vs Thymine
Why is uracil replaced by thymine in DNA?
The Genetic Code
Triplet code: Each codon consists of three nucleotides.
Degenerate: More than one codon can specify the same amino acid.
Codons for the same amino acid are similar; the third base varies most often.
Reading Frames
In double-stranded DNA (dsDNA), there are six potential reading frames.
Every mRNA has three potential reading frames.
There are only three possible reading frames in each strand because after three nucleotides, the codons repeat.
Correct Reading Frame
Translation usually begins with an AUG codon which encodes methionine (start codon).
Three codons (UAA, UAG, UGA) don't encode any amino acid and halt translation (stop codons or termination codons).
A continuous stretch of codons without a stop codon is called an open reading frame (ORF).
A complete ORF is bounded by a start and stop codon.
In eukaryotes, often the longest ORF is used.
Selection of the correct reading frame relies on features upstream of the start codon (RBS, Kozak sequence, Shine-Dalgarno sequence).
Experimental Workflow
Cloning:
Amplification of GFP insert by PCR.
Ligation of insert into plasmid vector.
Propagation of plasmid.
Purification of plasmid.
Restriction analysis.
Protein Expression:
Induction of GFP protein expression in bacteria.
Protein purification.
Verification by SDS-PAGE.
Verification by Western blotting.
Learning Objectives
Describe gene cloning and the purpose of cloning vectors.
Explain the steps involved in gene cloning.
Explain the concepts of restriction enzyme digestion:
In the context of cloning fragments into a specific plasmid.
In designing primers to allow cloning of an amplified DNA fragment.
Develop a simple cloning strategy for protein expression
Gene Cloning
Cloning involves taking a piece of DNA from the organism where it naturally occurs and transferring into a host organism.
Requirements for Cloning
DNA cloning is a technique for replication of DNA fragments
Vector is required to carry the DNA fragment of interest into the host cell.
The vector ensures that it is retained in the cell and passed onto daughter cells
Reasons for Cloning
cDNA libraries
Gene regulation
Synthesis of transcripts
Protein Expression
Site-directed mutagenesis
Genome editing
Methods of Cloning
Restriction enzyme + ligase
TA Cloning
Blunt End
Ligation independent cloning
Artificial synthesis
Steps Involved in Cloning
Foreign DNA (DNA Insert) and Cloning Vector are digested with Restriction Enzymes creating Sticky ends
DNA Ligase then joins the DNA Insert into the Plasmid
The Plasmid is then transferred into a Host Bacteria
Bacteria may take up plasmid with or without the insert, or may not take up plasmid at all
Blue/White screening allows to differentiate between Bacteria with the insert or without
Blue colonies - have plasmids without insert. Bacterial genome is missing the lacZ gene.
White colonies - have plasmids with the foreign insert.
Sources of DNA
Genomic DNA: DNA extracted from cells and purified
cDNA: Produced by reverse transcription of isolated mRNA
Synthetic DNA: Artificially synthesised using specific equipment
Amplified DNA: Generated using Polymerase Chain Reaction
Cloning Vectors
The purpose of the vector is to carry and maintain the foreign gene in the host cell. The vector can be replicated and passed onto new cells during cell division.
Different types of vectors:
Plasmids
Phagemids
Cosmids
Artificial Chromosomes (YACs, BACs)
All vectors share common characteristics that make them amenable to gene cloning
Cloning Strategy for Protein Expression
Identify region to be amplified
Select expression vector
Identify enzymes that will be used for cloning
Design forward and reverse primers with overhangs for cloning
Check the final reading frame to ensure that translation is correct
Optimise primer design if required (, Complementarity)
Cloning example
Designing primers to clone a cDNA into the pLAW44 bacterial expression vector
The resulting construct should encode the full-length protein
This protein is not expressed with a fusion tag
Identifying the region to be amplified
Primer Design for Cloning
Amplify Region
Identify regions for amplification on both strands of DNA.
Highlight annealing sites for forward and reverse primers.
Write the complementary 'primer' sequences.
DNA sequences are always written and documented 5’ → 3’
Forward primer binds to the NON-CODING strand. Therefore it must be COMPLIMENTARY to the non-coding strand. This makes it the SAME as the CODING strand!
Reverse primer binds to the CODING strand therefore it must look like the non-coding strand.
Restriction Enzyme Sites
Add RE recognition sites to the primer.
Add extra nucleotides to help with digestion (different for each enzyme).
One way to approach this is to pretend the RE sites are already present in the sequence.
In this example, BamHI (GGATCC) and HindIII (AAGCTT) are used.
Final PCR product
The overhanging regions on the primer do not have any complimentary regions in the original template.
The overhanging regions do form a part of the final PCR sequence however
Like all DNA sequences, the final PCR product should be reported as the coding strand (5’ → 3’)
Final primer sequences:
Forward: 5’ TTGGATCCATGGAAGATGCTTTGGATG 3’
Reverse: 5’ TTAAGCTTTCACAAATAGACATCG 3’
Primer Binding
How to find where primers bind in a sequence:
For the forward primer: Look for the same sequence in the coding strand
For the reverse primer: use the ‘reverse complement’ and look for the same sequence in the coding strand. Use https://www.bioinformatics.org/sms/rev_comp.html
Vectors
Select the expression vector pLAW44
Select enzymes that will be used for cloning
What restriction enzyme sites are available in the vector?
What restriction enzyme sites already exist in the sequence?
Do not use RE sites that appear in your gene!
We will use Bam HI (GGATCC) Hind III (AAGCTT)
Checking the Reading Frame
Enzymes
Digest with Bam HI (GGATCC) and Hind III (AAGCTT)
What next?
Attend the practical class on your specifically allocated day (Thursday or Friday)
Complete the associated LMS assessment module in Week 2 tab
Based on the provided resources and class notes (week 1-2 lectures and workshop 1 worksheet)
The LMS assessment module will be open on Friday 14 March at 5 pm, following the lab class and is due on Monday 17 March, 7.00 pm for everyone.
The settings for this quiz have been set to one attempt only
You can change answers as many times as you like before submission, however you can only submit your final answers once.
Note that any open assessments will be submitted automatically when the quiz closes.