BIO - DNA

Chapter 13-14 Study Guide 

(should you ONLY study this...NO! Look over the notes, edpuzzles, worksheets, gizmos etc)

Genes are made of DNA

  1. Understand the main idea of each experiment…. did their findings support each other or did they contradict? (Griffith, Hershey & Chase, Franklin, Watson, Crick, Avery)


  • Griffith- showed that a type of transformation principle could send the genetic information from bacteria to bacteria. 

  • Hershey & Chase- Showed that the proteins (not the DNA) is the genetic information/code that is passed down from parent to kid. 

  • Franklin- Used an x-ray to study DNA 

  • Watson & Crick- double-helix DNA structure 

  • Avery- Said the DNA is responsible for heredity not proteins (not a controlled experiment)


  1. Where is DNA located in the cell?


Nucleus 


  1. What is a bacteriophage? Summarize how Hershey and Chase manipulated them and what were their results?  Why was their experiment better than Avery’s at proving the hereditary information was in DNA and not proteins?


Bacteriophage is a type of virus that can grow and self replicate inside bacteria. They wanted to prove if DNA or proteins were the genetic material of bacteriophage. The let the phages infect the bacteria which resulted in the proteins being left outside which proved that DNA was the genetic material. 



The Structure of DNA

  1. Memorize the structure of a nucleotide and label all the parts


  • Contains nitrogen bases (A, T, C, G) in DNA and (A, U, C, G) in RNA

  • pentose sugar 

  • phosphate group 


  1. What are the 4 nitrogen bases found in DNA?


Thymine, Cytosine, Adenine, Guanine 


  1. What is the difference between purines and pyrimidines? Which bases belong to each?


Purines → double rings (Adenine, Guanine) 

Pyrimidines → single ring (Thymine, Cytosine) 


  1. How are the nucleotides bonded together to form DNA? (sugar-phosphate bond Vs nitrogen bases bond )


  • They are covalently bonded

  • Forms a sugar-phosphate backbone 

  • Nitrogen bases are on the inside 

  • A-T double hydrogen bond 

  • C-G triple hydrogen bond 


  1. Who were the first scientists to photograph DNA and discover the helical shape?


Rosalind Franklin and Maurice Wilkins were the first to photograph DNA. 

James Watson and Francis Crick discovered the helical shape. 


  1. Who were the scientists credited with discovering the double helical shape and that the nitrogen bases were located inside the sugar phosphate backbone?


James Watson and Francis Crick


  1. Write the complement to the following strand of DNA:

A T T A C C C C C C C G A G G A T T T A T A T A T G 

                                     TAATGGGGGGGCTCCTAAATATATAC

DNA Replication

  1. Describe DNA replication using the following terms: double helix, origins of replication, enzymes, helicase, DNA polymerase, leading strand, lagging strand,  forward, backward, 5 prime, 3 prime, Okazaki Fragments, primase, ligase, primer, original strand, parent strand, antiparallel, semiconservative.


Topoisomerase untwists the DNA’s double helix shape. Helicase then comes in a breaks the hydrogen bonds. Primase comes in and adds RNA primers to tell polymerase where to start working. Polymerase add the new strand. 

Leading strand→new strand formed going into the replication fork in the 5’ to 3’ direction 

Lagging strand→ starts inwards, polymerase adds bases in 5’ to 3’  direction in fragment working out of the fork. (creates the okazaki fragments) 

The fragments are linked together by ligase after exonuclease removes primers. 

Semiconservative → half original and half new 

Antiparallel→ the have a 3’ and 5’ end that are opposites of eachother



Identify the parts of DNA replication from the image below: (some aren’t just one word, but describing what’s happening) (not included is topoisomerase and exonuclease- but know them!)



A Replication Fork

B (SSB proteins- you don’t need to know this) 

C Nucleotides being brought over

D leading strand 

E helicase 

F primase 

G polymerase 

H primer

I lagging strand 

J exonuclease 

K okazaki fragments 

L ligase





 Protein Synthesis

  1. What is RNA? What type of sugar is found in this molecule?


  • RNA is a single strand that carries genetic information and acts as a “messenger” during protein synthesis. 

  • Ribose sugar 


  1. What are the 3 differences between DNA and RNA?


DNA- double helix, deoxyribose, thymine 

RNA- single strand, ribose, uracil


  1. What are the 2 steps of protein synthesis called?


transcription and translation 


  1. What occurs in transcription and where does this process take place?


  • It takes place in the nucleus

  • coverts DNA into mRNA by copying the code and removing the introns 

  • making specific directions for a protein 


  1. What are the differences between introns and exons? Which are used to make a protein?


Exons are the coding regions while intorns are the non-coding regions (only needed for specific proteins). Exons are used to make mRNA. 


  1. What occurs in translation and where does this process take place? (BE SPECIFIC and use the terms, mRNA, codon, tRNA, anticodon, ribosome, complement, amino acid, polypeptide chain, fold, and protein in your answer)

  • mRNA links to a ribosome, which calls an amino acid 

  • tRNA then carries the complements of the bases and amino acids to mRNA 

  • Anti- condon→complement base codon that matchs to the mRNA strand

  • Takes place in the cytoplasm 

  • mRNA is read in codons (3 bases) 

  • Stop signals don’t have an animo acid so the is no anti-codon 


  1. What is an anticodon? illustrate an example of how it is related to protein synthesis. (upload an image if you are doing this online)


  • Anti- condon→complement base codon that matchs to the mRNA strand


  1. What are the 2 types of RNA we discussed involved in protein synthesis and what does each do?


  • mRNA→carries the genetic information from the DNA out of the nucleus and attaches to a ribosome 

  • tRNA→brings the amino acids to the ribosome and matches them with the mRNA codons


  1. What is a codon? How many amino acids does each code for?


A codon is a sequence of 3 nucleotides and it codes for 1 amino acid.  


  1. How many nitrogen bases are in one codon?


3


  1. What is the difference between RNA and mRNA?


RNA comes from finding the complement of a DNA strand, which includes introns and exons. 

mRNA acts as a messenger which will bring the genetic information out of the nucleus, this only keeps the exons and introns are removed 


RNA→entire sequence 

mRNA→specific to what protein they are making 


  1. Can amino acids have more than 1 codon?


Yes


  1. Know how to read a codon wheel/chart




Base Mutations

  1. What are the types (names) of base mutations and what are the possible outcomes for each. (be specific)


Missense- amino acid is different

Nonsense- premature stop

silent- base is swapped for another, no change in amino acid


  1. If a base is inserted, which direction will the bases shift? (left or right)


right


  1. If a base is deleted, which direction will the bases shift? (left or right)

left


  1.  Which is more disastrous and why?

Frameshift because the gene would be read in in a different way which would cause them to code for different amino acids forming a different protein/non-functional protein. 

  1. What are the two real life examples we discuss in the notes and what kind of mutation are they? 


Sickle Cell Anemia-- Missense 

Cystic Fibrosis-- Frameshift 



You have a DNA sequence that codes for a protein and in 98 ncleotides long. A frameshift mutation occurs at the 61st base, how many amino acides will be correct and how many proteins will it code for.

If asking for AA→ MUST HAVE A START CONDON, STOP CONDON NO AA