Untitled

Distinguishing Between DNA and RNA

• Three ways to distinguish DNA from RNA:
  • DNA has deoxyribose sugar.
  • DNA is usually double-stranded.
  • DNA has thymine (T) instead of uracil (U).

Transcription and Translation Locations

• Eukaryotic Cell:

  • Transcription occurs in the nucleus.
  • Translation occurs in the cytoplasm.

• Prokaryotic Cell:

  • Transcription occurs in the cytoplasm.
  • Translation occurs in the cytoplasm.
  • Key feature: Lack of nuclear membrane helps distinguish between eukaryotes and prokaryotes.

Parts of a Gene

• Three parts of a gene:
  • Promoter:
  • Definition: The region where RNA polymerase binds to start transcription.
  • Coding Sequence:
  • Definition: The segment of the gene that is transcribed to mRNA.
  • Terminator:
  • Definition: Signals the end of transcription.

TATA Box and Transcription Factors

• The "TATA box" is found in the promoter region, where transcription factors and RNA polymerase bind.
• RNA Polymerase:
  • Function: Synthesizes RNA from a DNA template.

Transcription Factors

• Definition: Proteins that assist in the transcription process.
• Components: Made of Proteins.

mRNA Synthesis Example

• Given template DNA strand: 3' AGCTCAG 5'
  • mRNA sequence copied from this template is: 5' UCGAGUC 3'.
• Critical thinking: Given non-template strand (5' ACTTGAC 3') predicts:
  • mRNA sequence copied will be: 5' ACUUGAC 3'.

Eukaryotic mRNA Processing Events

• Three events before mRNAs exit the nucleus:
  • 5' Capping:
  • A modified guanine nucleotide added to the 5' end.
  • Splicing:
  • The process that removes introns from pre-mRNA.
  • 3' Polyadenylation:
  • Addition of a poly(A) tail to the 3' end of mRNA.

Function of Spliceosomes

• Function: Removes introns from pre-RNA to produce mature mRNA.

mRNA Protection Before Leaving the Nucleus

• Protection mechanisms:
  • At the 5' side: Cap
  • At the 3' side: Poly(A) tail.

Codons and Translational Start

• Number of bases in one codon: 3.
• Clarification on the term "codon":
  • Not referred to as "base pair" when talking about mRNA because it signifies the sequence of three nucleotides.
• Start Codon:
  • Nucleotide sequence of the start codon is AUG.
  • It signals the beginning of translation.

Analysis of Processed mRNA Sequence

• Given processed mRNA sequence: 5' GCAACAUGCGGUGCCUAUGAGCCAGCAAAAAA 3'

  • Mark the following:
  • 5' UTR: Region before the start codon.
  • Start Codon: AUG (codes for Methionine, the first amino acid).
  • Other Codons: GCG (Ala), GUG (Val), CCU (Pro), AGA (Arg).
  • Stop Codon: UAG (signals end of translation).
  • 3' UTR: Region after the stop codon.

• Translation using genetic code:

  • mRNA sequence is translated into its corresponding amino acids as described above.