Chapter 11: Transcription of the Genetic Code: The Biosynthesis of RNA

Cytosine Structure

  • Chemical Structure of Cytosine: NH₂ (Amino group), NH (Amine group)

RNA Base Components

  • Guanine

  • Adenine

  • Uracil

  • Cytosine

  • Thymine

Overview of Transcription

  • Definition: Transcription governs the expression of genes and the subsequent production of proteins.

  • Key Features of RNA Synthesis:
      1. RNA is synthesized using a DNA template, a process termed transcription.
      2. The enzyme facilitating this process is DNA-dependent RNA polymerase.
      3. Required components include all four ribonucleoside triphosphates: ATP, GTP, CTP, and UTP, along with Mg²⁺ ions.
      4. Unlike DNA synthesis, RNA synthesis does not require a primer, but necessitates a DNA template.
      5. RNA polymerase synthesizes RNA by extending from the 5' to the 3' end; the nucleotide at the 5' end retains its triphosphate group (ppp).
      6. The enzyme utilizes one strand of the DNA as a template, with base sequences providing signals for initiation and termination of RNA synthesis. The enzyme moves along the DNA template in the 3'-to-5' direction.
      7. The DNA template strand remains unchanged throughout the process.

Transcription in Prokaryotes

RNA Polymerase in Escherichia coli (E. coli)

  • Function: Catalyzes RNA synthesis on a DNA template.

  • Molecular Weight: Approximately 470,000 Da.

  • Structure:
      - Comprises five subunits: α, ω, β, β′, σ.
      - Core Enzyme Structure: α₂ωββ′ (absent of the σ subunit).
      - Holoenzyme Structure: α₂ωββ′σ (comprised of all components including coenzymes).

DNA Strands and their Role in Transcription

  • Template Strand (Antisense/[-] Strand): Serves specifically as the template for RNA synthesis.

  • Coding Strand (Sense/[+] Strand): Identical in sequence to the synthesized RNA, barring U instead of T.

  • Holoenzyme Binding: Binds to specific DNA sequences and only transcribes the template strand.

  • Promoter Recognition: The σ subunit identifies the promoter and is released once transcription commences.

  • Promoter Definition: A DNA region where RNA polymerase attaches at the start of transcription.

Basics of Transcription Diagram

Example Sequence

  • Coding Strand: 5' ATGGCATGCAATAGCT CATCG 3'

  • Template Strand: 3' TACGGTACGTTATCGAGTAGG 5'

  • RNA Transcript: 5' AUGGCA UGCAAUAGCUC 3'

  • RNA Polymerase Role: Catalyzes the transcription step.

  • Translation Sequence: Translated into a protein with amino acids.

Promoter Structure

  • Simple organisms present extensive non-transcribed DNA.

  • RNA polymerase requires knowledge about template strand orientation, transcription initiation point, and transcription strategy.

  • Promoters: Specific DNA sequences guiding RNA polymerase during transcription.

Representative Promoter Sequences from E. coli

  • Gene Examples:
      - araBAD
      - araC
      - bioA
      - bioB
      - galP2
      - lac (and its regulatory components)
      - tRNA Tyr

  • Consensus Structure: Includes upstream -35 and -10 (Pribnow box) regions, as well as transcription start site (+1).

  • Occurrence Rates: Display variability across different bases within promoter sequences.

Chain Initiation of Transcription

  • Initiation Phase: RNA polymerase binds to DNA, separating strands and initiating nucleotide binding.

  • Closed Complex Definition: Initial complex between RNA polymerase and DNA prior to transcription initiation.

  • Open Complex Forming: Completes the transition required for transcription to proceed.

Enhancers in Transcription

  • Definition: DNA sequences that enhance transcription rates through transcription factor binding.

  • Transcription Factors: Proteins affecting transcriptional levels by interacting with DNA.

  • Fis Sites: Specific upstream sequences facilitating ribosomal RNA gene expression.

Elements of a Bacterial Promoter

  • Core Elements: Include -35 and -10 regions along with the start site (+1).

  • UP Element: Enhances transcription efficacy, positioned upstream from core promoter elements.

  • Extended Promoter: Regions that can include additional transcription regulatory sites.

The Operon Concept

  • Definition: A functional unit consisting of an operator, promoter, and structural genes.

  • Structural Gene Role: Synthesizes a protein under regulatory control.

  • Genetic Regulation: Operons are often not transcribed constantly and are regulated through inducers.

  • Induction Mechanism: Triggered by the presence of specific inducers enabling gene transcription.

Lac Operon Details

  • Components:
      - β-galactosidase: Inducible protein synthesized from the structural gene lacZ.
      - LacY & LacA: Encode lactose permease and transacetylase, respectively.
      - lacI Gene: Regulates the transcription of structural genes, directing repressor protein synthesis.

  • Repressor Role: Binds to operator gene, inhibiting transcription of associated structural genes.

Control Sites in the Lac Operon

  • Operator (O): Binding site for repressor proteins affecting transcription.

  • Regulation: When the repressor occupies the operator site, RNA polymerase cannot access the promoter region, halting transcription and consequent translation processes.

Modes of Action: Lac Repressor

  • Inducer Presence: The lac operon is activated when E. coli is exposed to lactose but lacks glucose.

  • Catabolite Repression: Glycolytic metabolite glucose inhibits lac protein synthesis.

  • CAP-CAMP Complex Formation: In absence of glucose, cAMP forms a complex with CAP facilitating RNA polymerase binding to the promoter, initiating transcription.