Introduction to Phylogenetics, Homology, and Evolutionary Relationships
Phylogenies and the History of Life
- General Definition: A phylogeny is a visual representation of the evolutionary history of populations, genes, species, or clades.
- Familial Analogy: Phylogenetics is analogous (though not identical) to familial relationships (e.g., Grandparents, Parents, Aunt, Sister, Cousin).
- Diversity of Life (General Overview):
* Eucarya Groups: Land plants, Green algae, Dinoflagellates, Apicomplexans, Oomycetes, Foraminiferans, Microsporidia, Euglyphid amoebae, Radiolaria, Parabasalids, Leishmania, Diplomonads, Fungi, Ciliates, Red algae, Glaucophyte algae, Lobose amoebae, Cellular slime molds, Choanoflagellates, Animals, Diatoms, Euglena, Phaeophytes, Chrysophytes, Trypanosomes.
* Bacteria Groups: Epsilonproteobacteria (Mitochondria), Alphaproteobacteria, Green nonsulfur bacteria, Spirochetes, Chlamydia, Verrucomicrobia, Green sulfur bacteria, Actinobacteria, Cyanobacteria (Primary plastids), Thermotoga, Mycoplasmas.
* Archaea Groups: Pyrobaculum/Thermoproteus, Thermofilum, Archaeoglobus, Halophiles, Desulfurococcus, Pyrococcus/Thermococcus, Methanospirillum, Thermoplasma/Ferroplasma, Methanobacterium, Methanothermus.
Concepts of Homology
- Etymology:
* Homo = same.
* Logos = reason, plan.
- Definition: Shared characteristics across species that occur due to their common ancestry.
- Macroscopic Examples:
* Tails: Shared among Fishes, Amphibians, Reptiles, Birds, and Mammals.
* Frogs: The tail is lost during development.
* Apes (including humans): The tail is lost during development.
* Embryological Homology: Gill pouches are present in the early developmental stages of the Chick, Human, and House cat.
* Skeletal Homology: The forelimbs of humans (Right arm), bats (Right wing), cats, and whales share the same basic bone structure:
* Humerus
* Radius
* Ulna
* Carpals
* Metacarpals
* Phalanges
- Vestigial Structures: Traits that are reduced over time and no longer retain their primary function, though they are still present in related lineages.
* Example: The pelvic spur (a reduced femur) found on the albino Burmese python.
Genetic Homology and Eye Evolution
- Pax6 / Eyeless Gene: A control gene shared by a common ancestor across various lineages with complex or simple eyes.
- Genetic vs. Protein Similarity (Compared to Mouse Pax6):
* Fruit Fly (eyeless gene): Genetic similarity is 76.66%. Protein similarity is 100%.
* Shark (eye control gene): Genetic similarity is 35%. Protein similarity is 100%.
* Squid (eye control gene): Genetic similarity is 78.33%. Protein similarity is 100%.
* Flatworm (eye control gene): Genetic similarity is 71.66%. Protein similarity is 100%.
- Gene Sequences Comparison:
* Mouse Pax6:
GTATCCAACG GTTGmGTGAGTAAAATTCTG G GCAG GTATTACGAGACTG GCTCCATCAGA
* Fruit fly eyeless: GTATCAAATG GATGTGTGAQCAAAATTCTCG G GAG GTATTATGAAACAG GAAG CATACGA
* Shark eye control: GTGTCCAA CG GTTGTGTCAGTAA AATCCTG G GCAG ATACTATGAAACAG GATCCATCAG*
* Squid eye control: GTCTCCAACG GCTGCGTTAGCAAGATTCTCG GAOG GTACTATGAGACG G GCTCCATAAGA
* Flatworm eye control: GTGTCrAATGGTTGTGnTAGTAAAATACTTrGCCGATATTATGGAACAGGrrCTATTAAA
Homology vs. Homoplasy (Analogy)
- Homology: Shared similarities between taxa due to common ancestry (e.g., Human arm and Bat wing skeletal structure).
- Analogy (Homoplasy): Shared characteristics across taxa due to evolutionary processes (natural selection) and not shared ancestry.
- Functional Examples of Analogy:
* Flight Structures: A butterfly wing is analogous to a bird wing or a bat wing. While a mouse forelimb and a bat wing are homologous, the aerodynamic wing structure itself (between bats and birds) represents analogy.
- Complexity: The Eye:
* Complex eyes arose independently in vertebrates and cephalopods.
* Differences:
* Humans: Possess a blind spot, nerve fibers, bipolar cells, and a ciliary muscle.
* Cephalopods: Do not have a blind spot; contain an optic ganglion.
* Evolutionary Link: While the structure is analogous, the underlying control gene (Pax6) is homologous, shared by a common ancestor.
Phylogenetic Tree Structure and Terms
- Basic Components:
* Root: The base of the tree representing the oldest ancestor.
* Branch: Links nodes; represents the evolution of a lineage.
* Node (Internal node): A branching point representing a common ancestor.
* Terminal Node (Tip, leaf): The end of a branch, representing a specific taxon.
* Outgroup: A taxon outside the group of interest, used for comparison.
* Taxon/Taxa: A named group at any level of a hierarchy.
* Lineage: A continuous line of descent.
Branch Length Meanings (Summary Table 28.3)
- Cladogram Style:
* Branch lengths are arbitrary.
* Emphasis is on the branching pattern (topology).
* Estimates evolutionary relationships among populations relative to each other.
- Phylogram Style:
* Horizontal branch lengths show the extent of genetic difference among populations.
* Includes a scale bar representing base substitutions per site (e.g., 0.1 substitutions per site).
- Chronogram Style:
* Horizontal branch lengths represent evolutionary time between nodes.
* Includes a scale bar in units of time (e.g., Millions of years ago, ranging from 0 to 4).
Tree Interpretation and Rotation
- Nested Hierarchies: Life is organized by accumulating traits:
* Vertebrates: Characterized by skull, brain, and spine.
* Tetrapods: Characterized by legs, toes, neck, and loss of internal gills.
* Amniotes: Characterized by an amniotic egg (internal egg).
* Mammals: Characterized by hair and milk production.
- Node Rotation: A tree can be rotated on any node without changing the defined relationships. For example, a tree listing
(A, (B, C)) is identical to (A, (C, B)) or ((C, B), A). - Relationship Quiz:
* In a tree containing Frog, Lizard, Crocodile, and Bird:
* Accurate statement: A lizard is equally related to a crocodile and a bird (because they share a common ancestor that the frog does not).
* Inaccuracy: A frog is not more closely related to a lizard than to a bird.
Phylogenetic Groupings
- Monophyletic Group: Includes an ancestor and ALL of its descendants (e.g., Aves/Birds).
- Paraphyletic Group: Includes an ancestor and only SOME of its descendants (e.g., "Pisces" or Fish, which excludes land-dwelling tetrapods).
- Polyphyletic Group: A grouping of organisms that does not include their most recent common ancestor (e.g., grouping winged animals like bats and birds if the ancestor was flightless).
Discussion and Questions
- Question: Which phylogeny shows a DIFFERENT evolutionary relationship than the other trees?
- Question: In this tree, Pisces (fish) is a _____ group.
* Response: Paraphyletic.
- Self-Test Challenge: Try to draw two different equivalent phylogenetic trees based on a tree showing the traits "Superior Thoracic Artery" and "Loss of tail." To maintain relationships, the branching pattern must remain identical even if nodes are rotated.