Biotechnology I: Analysis of DNA
Biotechnology I: Analysis of DNA
Part 1: Introduction to DNA Technology
- Key Topics to Consider:
- Applications of DNA technology
- Enzymes important for manipulating DNA
- Definition of DNA cloning
- Historical context: Origins of DNA technology
Applications of Genetic Technology
- Large scale production of biological molecules (e.g., insulin)
- Identification of pathogens without culturing
- Genetic fingerprinting used in criminal forensics and paternity testing
- DNA Sequence Examples:
- Original: CGGATACCGTAAAAGCGGCTA
- Mutagenic Primer: CGGATACCGGAAAAGCGGCTA
- Gene Therapy:
- Design new alleles to study traits with desired characteristics
- Utilize DNA synthesis to introduce functioning genes into cells, restoring normal function.
- Characterization of Microbial Communities: Understanding the role of genes in diverse environments.
Historical Background
- Early 1970s: Introduction of recombinant DNA techniques.
- Researchers began producing recombinant DNA by joining pieces from different organisms.
- Resulted in the ability to introduce and replicate these constructs within living cells.
- Cloning: Manipulating DNA to create multiple identical copies of a sequence.
- Laboratory tools primarily derived from natural enzymes:
- DNA Polymerase: Synthesizes new DNA strands.
- DNA Ligase: Joins two DNA fragments together.
- Restriction Enzymes: Cut DNA at specific sequences, essential for creating recombinant DNA.
- Reverse Transcriptase: Used to synthesize DNA from an RNA template.
Types of Questions to Explore
- DNA Organization: How are genomes structured?
- Genomic Variability: How do species differ?
- Disease Association: Which genomic features relate to diseases?
- RNA and Protein Interactions: Investigate gene expression differences in health vs. disease and understand protein functionality and interactions.
- Cloning is often the initial step for investigating a specific gene or DNA sequence.
Part 2: Polymerase Chain Reaction (PCR)
- Critical Aspects of PCR:
- Denaturation: Heating to separate DNA strands.
- Annealing: Primers bind to target sequences.
- Extension: New DNA strands synthesized by DNA polymerase.
- Typically carried out in a thermocycler for 20-30 cycles.
- PCR Components:
- Template DNA (target)
- Taq DNA Polymerase derived from Thermus aquaticus
- dNTPs: Deoxynucleotides as building blocks of DNA
- Primers: Designed to match specific sequences for amplification, which are crucial for PCR success.
Primer Design Considerations
- Proper primer design is essential to focus amplification on desired DNA regions.
- Example of effective primers:
- Sequence: 5'-AGACTGATCGATAGGCGTTATTGTACCTCTGG-3'
- Complement: 3'-TCTGACTAGCTATCCGCAATAACATGGAGACC-5'
- Amplification goal: Use carefully designed primers to ensure the right sequence is targeted (between primer ends).
Part 3: Reverse Transcription PCR (RT-PCR)
- Purpose of Cloning Protein-Coding Sequences: Focus on mRNA translated into proteins, avoiding unnecessary intronic sequences.
- Reverse Transcriptase: Enzyme that converts RNA into cDNA (complementary DNA), allowing amplification without introns.
- cDNA Synthesis: Involves using a poly-A tail primer to generate cDNA from mRNA.
- Quantitative RT-PCR (qRT-PCR): Measures gene expression levels accurately by isolating mRNA and performing reverse transcription followed by PCR while quantifying DNA post each cycle.
Considerations when Cloning from Eukaryotes to Prokaryotes
- Eukaryotic vs Prokaryotic Genes: Distinct differences exist; common issues arise when trying to express eukaryotic genes in bacterial systems due to intron presence.
Part 4: Vectors and Restriction Enzymes
- Vectors: Independently replicating DNA pieces used to deliver foreign genetic material into host cells (typically plasmids or viruses).
- Vector Characteristics:
- Origin of replication for host cells, antibiotic resistance genes, multiple cloning sites for DNA insertion, promoters for gene expression.
- Restriction Enzymes: Cut DNA at specific sequences, generating sticky ends that facilitate the insertion of foreign DNA.
- Permanent DNA Join: Achieved using DNA ligase to seal nicks in the DNA backbone after the joining of two DNA fragments.
Method for Gene Insertion into Vectors
- Sequences can be engineered into genes during PCR, which can then be inserted into vectors to transform host cells.
- Identification of Transformed Cells: Using selective media (e.g., X-gal) where colonies are colored based on the presence of inserts; blue colonies lack inserts while white colonies contain them.
Gene Cloning Benefits
- Purposes include determining gene function, characterizing protein properties, and analyzing effects of mutations on functionality.
Common Group Questions and Problems with PCR Experiments
- Analyze results: Distinguish between product sizes from expected outcomes based on primer binding specificity.
- Expected Outcomes: Demonstration of how primer design can lead to amplification issues if not executed correctly, specifically in regards to the desired template circuitry.