Biotechnology I: Analysis of DNA

Biotechnology I: Analysis of DNA

Part 1: Introduction to DNA Technology

  • Key Topics to Consider:
    • Applications of DNA technology
    • Enzymes important for manipulating DNA
    • Definition of DNA cloning
    • Historical context: Origins of DNA technology
Applications of Genetic Technology
  • Large scale production of biological molecules (e.g., insulin)
  • Identification of pathogens without culturing
  • Genetic fingerprinting used in criminal forensics and paternity testing
  • DNA Sequence Examples:
    • Original: CGGATACCGTAAAAGCGGCTA
    • Mutagenic Primer: CGGATACCGGAAAAGCGGCTA
  • Gene Therapy:
    • Design new alleles to study traits with desired characteristics
    • Utilize DNA synthesis to introduce functioning genes into cells, restoring normal function.
  • Characterization of Microbial Communities: Understanding the role of genes in diverse environments.
Historical Background
  • Early 1970s: Introduction of recombinant DNA techniques.
    • Researchers began producing recombinant DNA by joining pieces from different organisms.
    • Resulted in the ability to introduce and replicate these constructs within living cells.
  • Cloning: Manipulating DNA to create multiple identical copies of a sequence.
Tools for Manipulating DNA
  • Laboratory tools primarily derived from natural enzymes:
    • DNA Polymerase: Synthesizes new DNA strands.
    • DNA Ligase: Joins two DNA fragments together.
    • Restriction Enzymes: Cut DNA at specific sequences, essential for creating recombinant DNA.
    • Reverse Transcriptase: Used to synthesize DNA from an RNA template.
Types of Questions to Explore
  • DNA Organization: How are genomes structured?
  • Genomic Variability: How do species differ?
  • Disease Association: Which genomic features relate to diseases?
  • RNA and Protein Interactions: Investigate gene expression differences in health vs. disease and understand protein functionality and interactions.
    • Cloning is often the initial step for investigating a specific gene or DNA sequence.

Part 2: Polymerase Chain Reaction (PCR)

  • Critical Aspects of PCR:
    • Three main steps:
    1. Denaturation: Heating to separate DNA strands.
    2. Annealing: Primers bind to target sequences.
    3. Extension: New DNA strands synthesized by DNA polymerase.
    • Typically carried out in a thermocycler for 20-30 cycles.
  • PCR Components:
    • Template DNA (target)
    • Taq DNA Polymerase derived from Thermus aquaticus
    • dNTPs: Deoxynucleotides as building blocks of DNA
    • Primers: Designed to match specific sequences for amplification, which are crucial for PCR success.
Primer Design Considerations
  • Proper primer design is essential to focus amplification on desired DNA regions.
  • Example of effective primers:
    • Sequence: 5'-AGACTGATCGATAGGCGTTATTGTACCTCTGG-3'
    • Complement: 3'-TCTGACTAGCTATCCGCAATAACATGGAGACC-5'
  • Amplification goal: Use carefully designed primers to ensure the right sequence is targeted (between primer ends).

Part 3: Reverse Transcription PCR (RT-PCR)

  • Purpose of Cloning Protein-Coding Sequences: Focus on mRNA translated into proteins, avoiding unnecessary intronic sequences.
  • Reverse Transcriptase: Enzyme that converts RNA into cDNA (complementary DNA), allowing amplification without introns.
  • cDNA Synthesis: Involves using a poly-A tail primer to generate cDNA from mRNA.
  • Quantitative RT-PCR (qRT-PCR): Measures gene expression levels accurately by isolating mRNA and performing reverse transcription followed by PCR while quantifying DNA post each cycle.
Considerations when Cloning from Eukaryotes to Prokaryotes
  • Eukaryotic vs Prokaryotic Genes: Distinct differences exist; common issues arise when trying to express eukaryotic genes in bacterial systems due to intron presence.

Part 4: Vectors and Restriction Enzymes

  • Vectors: Independently replicating DNA pieces used to deliver foreign genetic material into host cells (typically plasmids or viruses).
  • Vector Characteristics:
    • Origin of replication for host cells, antibiotic resistance genes, multiple cloning sites for DNA insertion, promoters for gene expression.
  • Restriction Enzymes: Cut DNA at specific sequences, generating sticky ends that facilitate the insertion of foreign DNA.
  • Permanent DNA Join: Achieved using DNA ligase to seal nicks in the DNA backbone after the joining of two DNA fragments.
Method for Gene Insertion into Vectors
  • Sequences can be engineered into genes during PCR, which can then be inserted into vectors to transform host cells.
  • Identification of Transformed Cells: Using selective media (e.g., X-gal) where colonies are colored based on the presence of inserts; blue colonies lack inserts while white colonies contain them.
Gene Cloning Benefits
  • Purposes include determining gene function, characterizing protein properties, and analyzing effects of mutations on functionality.
Common Group Questions and Problems with PCR Experiments
  • Analyze results: Distinguish between product sizes from expected outcomes based on primer binding specificity.
  • Expected Outcomes: Demonstration of how primer design can lead to amplification issues if not executed correctly, specifically in regards to the desired template circuitry.