U8: Microbial Genetics


Section 1: Introductory Terms & Nucleic Acid Structure

Introductory Terms

  • Genome: The entire genetic complement (all of the DNA) contained within an organism or cell.

  • Chromosome: Structurally organized structures within a cell that carry hereditary information containing the genes.

  • Prokaryotic Chromosomes: Typically a single, circular loop of double-stranded DNA localized in the nucleoid region.

  • Eukaryotic Chromosomes: Linear DNA molecules located inside a membrane-bound nucleus.

  • Plasmid: Tiny, self-replicating, extra-chromosomal circular pieces of double-stranded DNA. They are not essential for basic survival but often carry accessory genes (e.g., antibiotic resistance).

  • Gene: A specific sequence of nucleotides in DNA that codes for a functional product, usually a protein.

  • Genetics: The science and study of heredity and how traits are passed down.

  • Genomics: The molecular study and sequencing of genomes.

  • Genotype: The precise genetic makeup or collection of genes within an organism.

  • Phenotype: The actual, expressed physical traits or manifest structural/functional properties of an organism.

  • Bacterial Phenotypes: Structural traits like having a capsule, flagella arrangement, or metabolic traits like the ability to ferment a specific sugar (e.g., changing phenol red agar from red to yellow).

DNA vs. RNA Anatomy

Feature

DNA (Deoxyribonucleic Acid)

RNA (Ribonucleic Acid)

Sugar Pentose

Deoxyribose

Ribose

Nitrogenous Bases

Adenine (A), Thymine (T), Guanine (G), Cytosine (C)

Adenine (A), Uracil (U), Guanine (G), Cytosine (C)

Strand Structure

Double-stranded helix

Typically single-stranded

Function

Permanent storage of genetic code

Temporary transcript used to execute protein synthesis

The Three Laws of DNA Structure

  1. Directional (5' \rightarrow 3'): Phosphodiester backbones are highly directional. The 5' end terminates with a phosphate group, whereas the 3' end terminates with a hydroxyl group (-OH).

  2. Complementary: Nitrogenous bases interact selectively via hydrogen bonding. Adenine binds exclusively to Thymine (A=T, 2 hydrogen bonds), and Guanine binds exclusively to Cytosine (G \equiv C, 3 hydrogen bonds).

  3. Antiparallel: The two opposing strands run parallel to each other but point in opposite structural directions. One strand reads 5' \rightarrow 3', while its partner reads 3' \rightarrow 5'.

🧠 Memorization Aids & Mnemonics

Genotype vs. Phenotype

  • Genotype = Genes (the hidden blueprint)

  • Phenotype = Physical trait (what you can see/test, like a Picture)

DNA Base Pairing Rule

  • Apples in the Tree (A-T)

  • Cars in the Garage (C-G)

DNA Strands Direction

  • Think of a highway where lanes run side-by-side but cars face opposite directions (Antiparallel). The driver side always has a Phosphate at the 5' exit.

Section 2: DNA Replication

The Process of Replication

DNA replication is semiconservative. When a double helix replicates, each of the original parental strands serves as a template to build a brand-new daughter strand. The resulting granddaughter helices contain one old parental strand and one newly constructed daughter strand.

Parental:     | |
              / \
Daughter:    |i i|  <- (One old strand '|', one new strand 'i')

Cellular Energy

The structural synthesis of DNA requires chemical energy. This energy is extracted directly from the incoming building blocks themselves: Nucleoside Triphosphates (dATP, dTTP, dCTP, dGTP). When DNA Polymerase forms a phosphodiester bond, it cleaves off two terminal phosphate groups (pyrophosphate), releasing exergonic energy that drives the polymerization reaction.

Key Replication Enzymes & Proteins

  • DNA Gyrase (Topoisomerase): Relaxes supercoiled DNA and neutralizes structural tension ahead of the advancing replication fork.

  • Helicase: Unwinds the double-stranded DNA helix by ripping apart the hydrogen bonds holding base pairs together.

  • RNA Primase: Synthesizes a temporary, short RNA primer sequence. Why? DNA Polymerase cannot begin building a strand from scratch; it absolutely requires a pre-existing 3'-OH group to latch onto.

  • DNA Polymerase III: The main engine that synthesizes the new complementary DNA strand. It works exclusively by moving and appending nucleotides in the 5' \rightarrow 3' direction.

  • DNA Polymerase I: Snips out the temporary RNA primers and replaces them with accurate DNA nucleotides.

  • DNA Ligase: Covalently patches up structural nicks in the sugar-phosphate backbone, sealing fragments together.

Leading vs. Lagging Strands

Because DNA Polymerase can only operate in the 5' \rightarrow 3' direction, replication at the fork splits into two distinct modes:

  • Leading Strand: Synthesized continuously moving directly into the opening replication fork. It requires only one single RNA primer to initiate.

  • Lagging Strand: Synthesized discontinuously moving backwards away from the replication fork. It is constructed in short bursts called Okazaki fragments, each requiring a brand new RNA primer that must eventually be stitched together by DNA Ligase.

Replication Locations

  • Prokaryotes: Takes place in the cytoplasm (specifically the nucleoid region).

  • Eukaryotes: Takes place safely inside the nucleus.

🧠 Memorization Aids & Mnemonics

Replication Enzyme Match-Up

  • Gyrase = Guards against overwinding (un-twists supercoils).

  • Helicase = He-man breaks Hydrogen bonds (unzips the strands).

  • Primase = Places the Primer launchpad.

  • Ligase = Leroy the Glue Links the fragments together.

Directionality

  • DNA Polymerase is a strict writer: It can only write a new book from page 5 to 3 (5' \rightarrow 3').

Section 3: Protein Synthesis (The Central Dogma)

The general layout of cellular gene expression follows the Central Dogma:

\text{DNA} \xrightarrow{\text{Transcription}} \text{mRNA} \xrightarrow{\text{Translation}} \text{Protein} \xrightarrow{} \text{Function} \quad \text{[span_55](start_span)[span_55](end_span)}

Three Types of RNA

  1. mRNA (Messenger RNA): Carries the temporary copy of the genetic recipe from DNA down to the ribosome.

  2. tRNA (Transfer RNA): Acts as an adaptor molecule. It carries a specific amino acid on one side and matches its unique anticodon sequence to the mRNA codon on the other.

  3. rRNA (Ribosomal RNA): Composes the core physical catalytic subunits of the ribosome complex.

Part A: Transcription

Transcription is the process of copying a sequence of DNA nucleotides into a temporary complementary sequence of RNA nucleotides.

  • Key Enzyme: RNA Polymerase. It docks onto a structural region of DNA called the Promoter (the start signal), unwinds the helix, and synthesizes a complementary strand of RNA. It stops transcribing once it hits a Termination Sequence.

  • Sense (Coding) Strand: The strand of DNA that matches the exact sequence of the newly synthesized mRNA transcript (except DNA features Thymine, while RNA features Uracil).

  • Antisense (Template) Strand: The actual strand of DNA that RNA Polymerase physical latches onto and reads to create the complementary mRNA molecule.

Locations of Transcription

  • Prokaryotes: Cytoplasm. Transcription and translation can occur simultaneously on the same transcript.

  • Eukaryotes: Nucleus. The mRNA transcript must be structurally modified and exported to the cytoplasm before translation can begin.

Part B: Translation

Translation is the process where the sequence of codons on an mRNA molecule serves as a direct template to construct a precise sequence of amino acids into a functional protein.

Ribosomal Architecture & Sites

Prokaryotes utilize 70S ribosomes (composed of a 50S and a 30S subunit), whereas Eukaryotes utilize larger 80S ribosomes. Inside the ribosome, there are three functional pockets:

  1. A Site (Aminoacyl site): The entry point where incoming tRNA molecules carrying their assigned amino acid dock.

  2. P Site (Peptidyl site): Holds the growing peptide chain. This is also where the initial start codon (AUG, coding for Methionine) docks to kick off initiation.

  3. E Site (Exit site): The structural trap door where empty, uncharged tRNAs slide out and leave the ribosome.

   [ E ] [ P ] [ A ]
    Exit  Pep   Am
====================== mRNA Strand

Genetic Code Redundancy

mRNA is read in triplets of nucleotides known as codons. There are 64 possible structural combinations of codons, but they code for only 20 amino acids. Because multiple distinct codons can code for the exact same amino acid, the genetic code is described as redundant or degenerate.

🧠 Memorization Aids & Mnemonics

Ribosome Pocket Order

  • Read them backwards as they move through: A \rightarrow P \rightarrow E

  • A = Accepts incoming tRNAs.

  • P = Grows the Peptide chain.

  • E = Exits the building.

Start Codon Mnemonic

  • School starts in AUGust = AUG is the universal start codon (codes for Methionine).

Section 4: Gene Regulation & Operons

Cells regulate gene expression to preserve energy, ensuring that resource-heavy metabolic proteins are synthesized only when needed.

  • Constitutive Genes: Turn on permanently and produce proteins at a fixed, unchanging baseline rate.

  • Operon: A organized functional block of bacterial DNA containing a promoter region, an operator site, and a cluster of related structural genes that are controlled together.

Anatomy of an Operon

  • Regulatory Gene (I): Located upstream; constitutively transcribed to create the repressor protein.

  • Promoter (P): The binding runway where RNA Polymerase must land to begin transcription.

  • Operator (O): The operational traffic light downstream of the promoter. When an active repressor protein latches onto the operator, it acts as a physical wall, blocking RNA Polymerase from moving forward.

  • Structural Genes: The functional block of coding sequences that produce matching metabolic enzymes.

Inducible Operon (Example: The lac Operon)

Designed for catabolism (breaking down food sources). Default state is OFF.

  • In the Absence of Lactose: The regulatory gene produces an active repressor. This repressor naturally binds tightly to the operator site, physically blocking RNA Polymerase. No transcription occurs.

  • In the Presence of Lactose: Lactose is converted into its structural isomer allolactose (the inducer). Allolactose binds directly to the repressor protein, altering its shape. The repressor becomes inactive, drops off the operator, and RNA Polymerase proceeds to transcribe the structural genes (lacZ, lacY, lacA).

[No Lactose]  Promoter -> [Active Repressor Bound to Operator] -> Blocked[span_90](start_span)[span_90](end_span)!
[With Lactose] Inducer + Repressor = Inactive Repressor -> Operator Open -> Go[span_91](start_span)[span_91](end_span)!

Repressible Operon (Example: The trp Operon)

Designed for anabolism (building essential molecules). Default state is ON.

  • In the Absence of Tryptophan: The regulatory gene produces an inactive repressor that is physically incapable of binding to the operator. RNA Polymerase binds safely to the promoter and transcribes the structural genes to synthesize the amino acid tryptophan.

  • In the Presence of Excess Tryptophan: Tryptophan acts as a corepressor. It binds directly to the inactive repressor, activating its structural shape. The newly active repressor binds tightly to the operator, halting further transcription of tryptophan until levels decline.

Catabolite Repression (Positive Regulation)

Bacteria preferentially consume glucose over all other sugars because it yields the highest level of ATP with minimal preparation.

  • Cyclic AMP (cAMP): A molecular hunger signal.

  • \text{High Glucose} \rightarrow \text{Low cAMP}

  • \text{Low Glucose} \rightarrow \text{High cAMP}

  • CAP (Catabolite Activator Protein): Requires cAMP to activate. When glucose runs out, cAMP spikes, binding to CAP. This active cAMP-CAP complex docks onto the lac promoter, acting as a beacon that recruits RNA Polymerase to drive high-rate transcription of alternative sugar pathways (provided lactose is also present).

Growth Curve under Diauxic Conditions (Glucose + Lactose Present)

If a culture is grown with both sugars, it displays a distinct two-phase growth curve:

  1. Log Phase 1: Rapid, steep growth while consuming glucose.

  2. Lag Time: A flat plateau where population growth stalls. Why? The cell has run out of glucose and must take time to change its metabolic engines, accumulate cAMP, activate CAP, and turn on the lac operon.

  3. Log Phase 2: Slower exponential growth as the cell catabolizes lactose.

🧠 Memorization Aids & Mnemonics

Inducible vs. Repressible

  • Inducible = Normally Inactive (turned OFF, needs an Inducer to start).

  • Repressible = Normally Running (turned ON, needs a co-Repressor to stop).

cAMP Level Mnemonic

  • Think of cAMP as a structural "Campfire" you build when you are stranded and starving in the woods.

  • No food (Glucose) = You build a big Campfire (High cAMP).

  • Tons of food (Glucose) = No need for a Campfire (Low cAMP).

Section 5: Mutations & DNA Repair

A mutation is a permanent structural change in the nitrogenous base sequence of a DNA molecule.

Classification of Mutations

  • Silent Mutation: A point mutation where a single base substitution alters a codon, but due to genetic code redundancy, it codes for the exact same amino acid. The structural protein remains unchanged.

  • Missense Mutation: A point mutation base substitution that changes a single codon, resulting in a completely different amino acid inserting into the final protein.

  • Nonsense Mutation: A base substitution that accidentally converts a standard amino acid codon into a premature Stop Codon. This truncates the translation process, resulting in an incomplete, nonfunctional protein fragment.

  • Frameshift Mutation: The insertion or deletion of one or more nucleotide bases (not in multiples of three). This throws off the triplet reading frame downstream, scrambling every subsequent codon and protein structure.

Wild Type:   THE DOG RAN FOR THE CAT[span_99](start_span)[span_99](end_span)
Frameshift:  THE DDO GRA NFO RTH ECA T... (Scrambled!)[span_100](start_span)[span_100](end_span)

Mutagens vs. Spontaneous Rates

  • Spontaneous Mutations: Happen randomly in the absence of mutagens due to occasional typos made by replication enzymes (about 1 in 10^9 replicated base pairs).

  • Mutagens: Physical or chemical external agents that accelerate mutation rates drastically (10^{-5} to 10^{-3}).

  • Ionizing Radiation (X-Rays/Gamma Rays): Breakers that shatter the sugar-phosphate backbone and ionize cellular molecules.

  • UV Radiation: Non-ionizing light that causes adjacent Thymine bases on a strand to cross-link covalently, creating a bulky Thymine Dimer that stalls replication forks.

UV Repair Mechanisms

  1. Light-Dependent Repair (Photoreactivation): Cells utilize the enzyme Photolyase. When activated by visible light, it binds directly to the thymine dimer and snips the incorrect cross-link bond cleanly without cutting the DNA backbone.

  2. Light-Independent Repair (Dark/Excision Repair): A multi-enzyme process:

  • Endonuclease cuts out the single-stranded section containing the damage.

  • DNA Polymerase enters the gap to synthesize fresh, accurate DNA using the opposite strand as a guide.

  • DNA Ligase seals the remaining molecular nick.

🧠 Memorization Aids & Mnemonics

Mutation Types

  • Silent = Shhh! No one knows (amino acid stays the same).

  • Missense = Mistake (switches one amino acid for another).

  • Nonsense = Stop this Nonsense! (creates a premature Stop codon).

Section 6: Genetic Diversity & Recombination

Horizontal vs. Vertical Gene Transfer

  • Vertical Gene Transfer: The passing of genetic information from a parent cell down to its subsequent generation of offspring cells via binary fission or reproduction.

  • Horizontal Gene Transfer: The physical transfer of genes between independent bacterial cells belonging to the exact same generation.

The Three Methods of Horizontal Gene Transfer

1. Transformation

The process where a competent recipient bacterial cell imports naked, free-floating fragments of donor DNA directly out of its surrounding fluid environment.

  • Griffith’s Historic Mouse Experiment:

  • Living Encapsulated (S) Strain: Smooth capsule hides bacteria from host phagocytes \rightarrow Mouse Dies.

  • Living Non-Encapsulated (R) Strain: Rough mutant lacking capsule \rightarrow Mouse Lives.

  • Heat-Killed S Strain: Dead encapsulated bacteria \rightarrow Mouse Lives.

  • Mixture of Heat-Killed S + Living R Strain: The dead S strain cells lysed and spilled their structural DNA. The living R strain cells naturally imported those naked capsule genes, transforming into virulent S cells \rightarrow Mouse Dies.

Free Floating Naked DNA ----> [ Competent Recipient Cell ] ----> Recombines into Chromosome

2. Conjugation

The direct transfer of genetic plasmids from a donor cell to a recipient cell requiring physical cell-to-cell contact through a specialized sex pilus.

  • F^+ \times F^- Cross: An F^+ cell (carrying the Fertility Plasmid) extends a sex pilus to link up with an F^- recipient. It unwinds and passes a single strand of the plasmid over. Both cells synthesize a complementary strand, transforming the recipient into a fully functional, active F^+ cell.

  • Hfr Cells (High Frequency of Recombination): Occasionally, the circular F plasmid physically integrates directly into the primary circular host chromosome.

  • Hfr \times F^- Cross: When an Hfr cell transfers genes, it treats its entire chromosome like a massive plasmid. Rolling replication begins pushing across the chromosome. However, the fragile bridge almost always ruptures mid-transfer. The recipient cell imports fresh chromosomal donor genes but fails to receive the entire F-factor sequence; thus, it remains F^- but recombinant.

3. Transduction

The accidental transfer of host bacterial genes from a donor cell to a recipient cell mediated by a replicating virus called a bacteriophage.

  • Generalized Transduction (Lytic Cycle): During viral assembly, the phage enzymes mistakenly chop up host DNA. A random fragment of bacterial DNA is incorrectly packaged into a viral capsid instead of viral code. This "sloppy package" delivers bacterial donor code into the next host cell.

  • Specialized Transduction (Lysogenic Cycle): A prophage integrates directly into the host chromosome. When it later undergoes excision to return to the lytic pathway, it cuts inaccurately, carrying a very specific, neighboring bacterial chromosome gene along with it into every new viral capsid.

🧠 Memorization Aids & Mnemonics

Horizontal Gene Transfer Mechanics

  • Transformation = Takes up Trash DNA (naked, free-floating environment DNA).

  • Conjugation = Requires a Conjugal visit (intimate physical contact via a sex pilus).

  • Transduction = Delivered by a Disease-carrying vector (Bacteriophage virus).


UNIT 8: Worksheets

Here are the comprehensive answers to all the questions from each of your worksheets, formatted as an expert-level master study guide.

Part 1: Answers to "Operons Worksheet"

1. Describe the nature of DNA and RNA.

  • DNA (Deoxyribonucleic Acid): A double-stranded helix consisting of a sugar-phosphate backbone with deoxyribose sugar and four nitrogenous bases: Adenine (A), Thymine (T), Guanine (G), and Cytosine (C). It is directional (5' \rightarrow 3'), complementary, and antiparallel, functioning as the permanent master storage blueprint for cell life.

  • RNA (Ribonucleic Acid): Typically a single-stranded nucleic acid composed of a ribose sugar backbone and the nitrogenous bases Adenine (A), Uracil (U) (replacing Thymine), Guanine (G), and Cytosine (C). It functions primarily as a temporary transcript or adaptor molecule to build physical proteins during protein synthesis.

2. What is a gene?

  • A gene is a specific structural segment or sequence of nucleotides within a DNA molecule that carries the exact code or recipe needed to produce a single, functional cellular product, usually a protein.

3. What is RNA polymerase and what is its role in a cell?

  • RNA Polymerase is the principal enzyme responsible for transcription. Its role is to latch onto the DNA at a region called the promoter, unwind the double helix, read the template (antisense) DNA strand, and join complementary RNA nucleotides together to construct a single-stranded mRNA molecule.

4. What does it mean when genes are constitutive?

  • Constitutive genes are unregulated genes that are expressed at a fixed, constant rate. The cell continuously transcribes and translates these genes because their protein products are essential for basic, routine cellular survival and metabolism.

5. What is an operon?

  • An operon is a coordinated functional block of bacterial DNA consisting of a single control region (a promoter and an operator site) that regulates a cluster of related downstream structural genes. These genes are transcribed together into a single mRNA transcript to optimize resource usage.

6. Are repressor genes always transcribed?

  • Yes. The regulatory gene (denoted as the I gene) is constitutive, meaning it is continuously transcribed at a low baseline rate to maintain a steady concentration of repressor proteins ready within the cell.

7. Below is a picture of the lac operon. Label the parts and explain their purpose.

Based on the standard regulatory diagram layout:

  • I (Regulatory Gene): Located upstream of the operon; it codes for the repressor protein.

  • P (Promoter): The structural runway where RNA Polymerase must bind to start transcription.

  • O (Operator): The molecular traffic light or switch located between the promoter and structural genes. It serves as the physical binding pocket for the repressor protein.

  • Z, Y, A (Structural Genes): The coding sequences transcribed collectively.

  • lacZ codes for \beta-galactosidase (breaks lactose into glucose + galactose).

  • lacY codes for lactose permease (pumps lactose into the cell).

  • lacA codes for transacetylase (helps clear metabolic byproducts).

8. What is an inducible operon vs. a repressible operon?

  • Inducible Operon: Default state is OFF. The active repressor is naturally bound to the operator, blocking transcription. It turns ON only when a specific chemical signal (an inducer) binds to and deactivates the repressor. (Example: The lac operon).

  • Repressible Operon: Default state is ON. The repressor protein is produced in an inactive state, allowing RNA polymerase to transcribe freely. It turns OFF only when an abundance of an end-product (a corepressor) binds to and activates the repressor, allowing it to dock onto the operator. (Example: The trp operon).

9. What is happening in the following pictures? Label appropriately.

  • Picture 1 (Lactose Absent): Active repressor protein binds directly to the operator (O). This acts as a physical wall that blocks RNA Polymerase from moving downstream, keeping transcription OFF.

  • Picture 2 (Lactose Present): The inducer (allolactose) binds to the repressor protein, causing it to alter its physical shape and become inactive. The repressor detaches from the operator site, clearing the path for RNA Polymerase to transcribe genes Z, Y, and A (ON).

10. What is the primary energy source in a prokaryotic cell? How does this relate to catabolite repression?

  • Glucose is the preferred and primary carbon energy source.

  • Relationship to Catabolite Repression: Catabolite repression acts as a global override that prevents the cell from wasting precious energy transcribing alternative sugar operons (like lactose) as long as glucose is available, even if lactose is present in the media.

11. What is CAP and cAMP and how does it affect the lac operon?

  • cAMP (Cyclic AMP): An internal starvation alarm molecule. When glucose is depleted, cAMP levels spike. When glucose is high, cAMP levels drop.

  • CAP (Catabolite Activator Protein): An allosteric activator protein that needs cAMP to wake up.

  • Effect on the Lac Operon: When glucose is absent, the cAMP-CAP complex forms and docks onto a site right next to the lac promoter. This complex acts as a physical beacon that physically recruits RNA Polymerase, triggering high-volume transcription of the operon (as long as lactose is present).

12. What is the following picture describing? Label the picture.

  • This picture describes Diauxic Growth (the two-phased bacterial growth curve observed when both glucose and lactose are provided).

  • Labels:

  • First steep slope (Log Phase 1): Growth using preferred glucose energy.

  • The flat plateau (Lag time): Glucose runs dry; growth halts while the cell accumulates cAMP, activates CAP, and synthesizes the lac enzymes.

  • Second gentle slope (Log Phase 2): Growth resumes at a slower rate using lactose.

13. When would a cell need to synthesize the amino acid tryptophan?

  • A cell needs to synthesize tryptophan when environmental levels of tryptophan are completely depleted or absent, meaning the bacterium cannot salvage it from its surrounding medium and must build it from scratch.

14. How does tryptophan affect the trp operon?

  • Tryptophan acts directly as a corepressor. When tryptophan builds up in excess inside the cell, it binds to the naturally inactive trp repressor. This changes the repressor's shape into an active configuration, allowing it to lock tightly onto the trp operator and turn transcription OFF.

🧠 Memorization Aids & Mnemonics

Operon Types Mnemonic

  • Inducible = Normally Inactive (Starts OFF, requires an Inducer like Lactose to kick it on).

  • Repressible = Normally Running (Starts ON, requires a co-Repressor like Tryptophan to turn it off).

Part 2: Answers to "Gene Expression and Mutations Worksheet"

1. Chemically, how does RNA differ from DNA?

  1. Sugar: RNA contains ribose sugar (with a hydroxyl group on carbon 2), whereas DNA contains deoxyribose sugar (missing an oxygen atom).

  2. Bases: RNA uses Uracil (U) to pair with Adenine, while DNA uses Thymine (T).

  3. Strands: RNA is typically a single-stranded molecule, whereas DNA forms a stable, double-stranded helix.

2. What are the base-pairing rules for making an mRNA transcript of a DNA gene?

  • Adenine (A) in DNA transcripts to \rightarrow Uracil (U) in RNA.

  • Thymine (T) in DNA transcripts to \rightarrow Adenine (A) in RNA.

  • Guanine (G) in DNA transcripts to \rightarrow Cytosine (C) in RNA.

  • Cytosine (C) in DNA transcripts to \rightarrow Guanine (G) in RNA.

3. Complete Transcription Exercise

  • Given DNA Sequence: \text{Top Strand: } 5' \text{- GTAACCGTATTGCAGCTATTAGCAGCCATG - } 3' \text{Bottom Strand: } 3' \text{- CATTGGCATAACGTCGATAATCGTCGGTAC - } 5'

  • Rule: The problem states the bottom strand carries the gene (the template/antisense strand). RNA polymerase reads template strands from 3' \rightarrow 5' to synthesize mRNA from 5' \rightarrow 3'.

  • Resulting mRNA sequence (5' \rightarrow 3'): \mathbf{5' \text{- GUAACCGUAUUGCAGCUAUUAGCAGCCAUG - } 3'}

4. Which strand (top or bottom) would the promoter be found on? Why?

  • Answer: The bottom strand (3' \rightarrow 5' template strand).

  • Why: The promoter is the structural sequence that sits directly upstream on the exact template strand that RNA Polymerase needs to lock onto and read.

5. Divide the mRNA into its 10 codons:

Taking the mRNA transcript from Question 3, we group them into consecutive base triplets:

\mathbf{\text{[GUA] [ACC] [GUA] [UUG] [CAG] [CUA] [UUA] [GCA] [GCC] [AUG]}}

6. Explain how mRNA and tRNA work together to get amino acids into their correct places in the protein.

  • The mRNA strand carries the linear sequence of triplet codons from the DNA out to the ribosome.

  • The tRNA acts as an adaptor bridge: one end carries a specific, designated amino acid, while the opposite loop displays a complementary three-base loop called an anticodon.

  • Inside the ribosomal complex, the tRNA anticodon temporarily hydrogen-bonds to its matching mRNA codon, ensuring that amino acids are added to the growing peptide chain in the precise sequence dictated by the master genetic blueprint.

7. Translation using the Genetic Code Table:

Let's translate each codon step-by-step using the provided table:

  1. GUA \rightarrow Valine (Val)

  2. ACC \rightarrow Threonine (Thr)

  3. GUA \rightarrow Valine (Val)

  4. UUG \rightarrow Leucine (Leu)

  5. CAG \rightarrow Glutamine (Gln)

  6. CUA \rightarrow Leucine (Leu)

  7. UUA \rightarrow Leucine (Leu)

  8. GCA \rightarrow Alanine (Ala)

  9. GCC \rightarrow Alanine (Ala)

  10. AUG \rightarrow Methionine / Start (Met)

  • Final Amino Acid Sequence: \mathbf{\text{Val — Thr — Val — Leu — Gln — Leu — Leu — Ala — Ala — Met}}

Part 3: Answers to "Genetics Review Questions"

  1. Consider a strand of DNA with the sequence GAATTCGGCA. What is the sequence of the complementary strand?

  • Answer: CTTAAGCCGT (following the standard DNA base pairing rules: G-C, A-T).

  1. In a bacterial species, 20% of the bases in its DNA are C. What percent of the bases are G?

  • Answer: C) 20% (By Chargaff's rules, the percentage of Cytosine always matches the percentage of Guanine).

  1. Nucleotides in opposing strands of DNA that bind to each other are called

  • Answer: B) complementary.

  1. Which of the following pairs with adenine in a DNA molecule?

  • Answer: B) thymine.

  1. A sequence of DNA codes for a

  • Answer: A) protein.

  1. The structure of a protein is determined by

  • Answer: B) the sequence of the amino acids it contains.

  1. Which molecule remains in the nucleus during protein synthesis?

  • Answer: A) DNA.

  1. Which of the following serves as the template during translation?

  • Answer: B) mRNA.

  1. The process of copying a sequence of DNA nucleotides into a complementary sequence of RNA nucleotides is called

  • Answer: C) transcription.

  1. The RNA molecule that carries the sequence of nucleotides needed to determine the order of amino acids in a protein is

  • Answer: C) messenger RNA.

  1. RNA polymerase binds to the ______ to begin the process of transcription.

  • Answer: A) promoter.

  1. Which of the following is found in the nucleotides of DNA but NOT in RNA?

  • Answer: C) deoxyribose.

  1. Which of the following serves as the template during transcription?

  • Answer: A) DNA.

  1. Ribosomes are made of subunits that are composed of

  • Answer: C) rRNA and proteins.

  1. Which of the following always contain three nucleotides?

  • Answer: B) an anticodon (or codon).

  1. A double-stranded DNA molecule that has 22% guanine will have

  • Answer: D) 48% thymine * Calculation: If Guanine is 22%, Cytosine is 22% (Total G+C = 44\%). The remaining 56\% must be divided evenly between Adenine and Thymine (56\% / 2 = 28\% each). Note: The answer choices in the snippet contain an error, but mathematically it is 28%. If choice D states a value closest to this or 28%, select it.

  1. When a mutation results in no significant change in the production of a functional protein, it's called a

  • Answer: D) neutral mutation (often caused by a structural silent mutation).

  1. What is the sequence of the mRNA made from the DNA gene sequence TTACAGGTCC?

  • Answer: AAUGUCCAGG (transcribed complementary 5' \rightarrow 3').

Part 4: Answers to "Study Unit 8 - Microbial Genetics Worksheet"

Page 2: Identify the three basic morphologies (shapes) of bacteria and their arrangements.

  • Three Shapes:

  1. Bacillus: Rod-shaped.

  2. Coccus: Round/spherical.

  3. Spiral: Spirillum, Vibrio (comma), or Spirochete.

  • Arrangements: Single, Diplo (pairs), Strepto (chains), Staphylo (clusters), Tetrad (four in a square), and Sarcinae (eight-cell cubes).

Page 3: Definitions

  • Genetics: The science and study of heredity.

  • Genome: The entire genetic complement (all of the DNA) inside a cell.

  • Chromosome: Cellular structure carrying hereditary DNA containing genes.

  • Gene: A base sequence coding for a specific functional protein.

  • Genetic Code: The set of rules by which information encoded in genetic material is translated into proteins.

  • Genotype: An organism's exact collection of genes (internal blueprint).

  • Phenotype: The actual physically expressed traits or functional properties.

  • Genomics: The molecular study and sequencing of complete genomes.

Page 4: How does DNA serve as genetic information?

  • DNA acts as information storage through its linear sequence of nitrogenous bases. This specific sequence of letters acts as a code that directly determines the primary sequence of amino acids used to build functional cellular proteins.

Pages 5-6: DNA Replication Process and Enzymes

  • Process: Semiconservative replication splits the parental helix to construct two identical copies, each keeping one old strand and one new daughter strand.

  • The Enzymes:

  • DNA Gyrase: Unwinds supercoils ahead of the fork.

  • Helicase: Unzips the two strands by breaking hydrogen bonds.

  • RNA Primase: Lays down the RNA primer anchor.

  • DNA Polymerase III: Main synthesizer; adds nucleotides 5' \rightarrow 3'.

  • DNA Polymerase I: Replaces RNA primers with DNA.

  • DNA Ligase: Glues Okazaki fragments together on the lagging strand.

Pages 7-8: Protein Synthesis & Prokaryote vs. Eukaryote Comparison

  • Prokaryotes: Takes place in the cytoplasm. Uses 70S ribosomes. Transcription and translation occur simultaneously on the same transcript because there is no nuclear membrane barrier.

  • Eukaryotes: Transcription takes place inside the nucleus, and the mRNA must be modified (introns removed) and exported to the cytoplasm, where translation occurs on 80S ribosomes.

Page 13: Pathway Diagram Application Questions

  • a. If enzyme a is inducible and is not being synthesized:

  • (1) repressor protein must be bound tightly to the (2) operator site. When the inducer is present, it will bind to the (3) repressor protein so that (4) transcription can occur.

  • b. If enzyme a is repressible:

  • The end-product C is called a (1) corepressor. It causes the (2) inactive repressor to bind to the (3) operator.

  • What causes derepression? When the end-product C is entirely depleted, the repressor reverts to its empty, inactive shape and falls off the operator site, turning the operon back ON.

Page 15: Mutation Classifications

  • Silent: Changes a base but preserves the exact same amino acid sequence.

  • Missense: Changes a base, resulting in the substitution of a different amino acid.

  • Nonsense: Introduces a premature stop codon, chopping the protein short.

  • Frameshift: An insertion or deletion of bases that shifts the triplet reading frame, scrambling all subsequent amino acids.

Page 16: Two Ways Mutations are Repaired (UV Damage)

  1. Light Repair (Photoreactivation): Photolyase uses visible light energy to locate and snip the covalent bonds of thymine dimers directly.

  2. Dark Repair (Excision Repair): Endonucleases clip out the damaged strand segment, DNA Polymerase I fills the gap with fresh nucleotides, and DNA Ligase seals the backbone.

Page 19: Horizontal vs. Vertical Gene Transfer

  • Vertical Transfer: Passing genetic material down from a parent cell to its immediate offspring via binary fission or reproduction.

  • Horizontal Transfer: The physical transfer of genes between independent cells within the same generation.

Page 22: Conjugation Crosses Comparison

  • F^+ \times F^- Cross: The donor cell passes a copy of its circular F plasmid to an F^- recipient cell through a sex pilus. The outcome results in two F^+ cells.

  • Hfr \times F^- Cross: The F plasmid has integrated directly into the donor's main chromosome. During conjugation, it tries to transfer the entire host chromosome. The bridge breaks early; therefore, the recipient cell imports new random chromosomal genes but remains F^- (recombinant).