DNA sequencing

What is the difference between the deoxynucleotide and the dideoxynucleotide?

• The deoxynucleotide is the building block of DNA. It has a 3′-OH group while the dideoxynucleotide lacks the 3′-OH needed to add another nucleotide.

• Deoxynucleotide allows DNA synthesis, while dieoxynucleotide stops DNA synthesis.

The principle of chain termination sequencing

• In chain-termination DNA sequencing, DNA synthesis is performed on a sample (template) using deoxy and dideoxy nucleotides.

• Each reaction is PARTIAL; the chain-terminating dideoxy nucleotide is randomly incorporated into the newly synthesised DNA chain.

• RESULT: DNA segments of different lengths with a common 5’ end (sequencing primer) and different 3 ‘ends (template DNA complement).

Components of the sequencing reaction

• Template DNA (genomic, plasmid, phage, PCR product)

• Sequencing primer (15-25 nucleotides in length determines the start point ).

• dNTP (can be marked or unmarked).

• ddNTP

• Sequencing enzyme (DNA polymerase, e.g., T7, Taq).

Electrophoresis

• Different in one nucleotide from each other.

• It is suitable for separating DNA fragments.

TWO METHODS OF ELECTROPHORESIS:

1. Denaturing Polyacrylamide gel electrophoresis.

2. Capillary electrophoresis.

Methods of detection- radioactive detection:

What the slide means

Your slide is about radioactive detection used in DNA sequencing (especially early Sanger sequencing).

So the roles are:

Radioactive detection process (what your slide lists)

1. Radiolabeled deoxynucleotide is incorporated

   • A nucleotide containing a radioactive isotope (often (^{32}P)) is added during DNA synthesis.

   • The DNA fragments become radioactively labelled.

2. Electrophoresis

   • DNA fragments are separated on a polyacrylamide gel.

3. Gel drying

   • The gel is dried onto filter paper to stabilise it.

4. Autoradiographic development

   • The gel is placed against X-ray film.

   • Radiation from the DNA exposes the film, producing bands.

5. Sequence reading

   • The band pattern is read from bottom to top to determine the DNA sequence.

Key clarification

These are methods of detection, not electrophoresis types.

Modern sequencing mostly uses fluorescent detection instead of radioactive detection.

1. What this slide is showing (Setup of the experiment)

Components in the reaction

You start with:

1. Single-stranded template DNA

5' CGAATGCTCAGGCCATCATC 3'

This is the DNA sequence we want to determine.

2. Primer

• A short DNA fragment that binds to the template.

• DNA polymerase starts synthesis from the primer.

3. DNA polymerase

• An enzyme that adds nucleotides to extend the new strand.

4. Normal nucleotides (dNTPs)

• dATP, dCTP, dGTP, dTTP

• Used to build the new DNA strand.

5. Radioactive nucleotide

• Example: [α³³P] dATP

• This labels the DNA so it can be detected later.

The key idea: four separate reactions

The mixture is divided into four tubes, each containing a different dideoxynucleotide:

Why ddNTPs matter

A dideoxynucleotide (ddNTP):

• Stops DNA synthesis

• because it lacks the 3'-OH group

So when a ddNTP is inserted:

➡ DNA cannot extend further
➡ The chain terminates

This produces DNA fragments of different lengths.

The slide shows what happens in two of the tubes.

A reaction (dNTP + ddATP)

Whenever an A should be added, sometimes ddATP is inserted instead of dATP.

When that happens:

➡ DNA synthesis stops at that position

So you get fragments ending at every A position.

Example fragments shown:

AG
AGTAG
AGTCCGGTAGTAG
ACGAGTCCGGTAGTAG

Each fragment ends with A.

C reaction (dNTP + ddCTP)

Same idea.

Whenever C should be added, ddCTP may terminate the chain.

Fragments end at C positions.

Example fragments:

CGGTAGTAG
CCGGTAGTAG
CGAGTCCGGTAGTAG
CTTACGAGTCCGGTAGTAG

3. What this slide shows (G and T reactions)

The other two tubes work the same way.

G reaction (dNTP + ddGTP)

Fragments terminate at G.

Examples:

G
GTAG
GTAGTAG
GGGTAGTAG

T reaction (dNTP + ddTTP)

Fragments terminate at T.

Examples:

TAG
TAGTAG
TCCGGTAGTAG

Electrophoresis and Detection:

1. Four lanes (A, C, G, T)

After the sequencing reactions, you have four tubes:

• A reaction → fragments ending in A

• C reaction → fragments ending in C

• G reaction → fragments ending in G

• T reaction → fragments ending in T

Each reaction is loaded into a separate lane of the gel.

A | C | G | T

2. DNA moves in the electric field

DNA is negatively charged because of its phosphate backbone.

So it moves:

from the negative electrode (top)
➡ toward the positive electrode (bottom)

3. Separation by size

During electrophoresis:

• Small DNA fragments move faster

• Large fragments move more slowly

So on the gel:

4. Bands appear after detection

After autoradiography, the gel shows bands where DNA fragments are located.

Each band corresponds to one DNA fragment length.

5. How the sequence is read

You read the bands from bottom → top.

Why?

Because:

• Bottom = shortest fragment

• Shortest fragment = first nucleotide added after the primer

Example reading:

Bottom band → T
Next band → G
Next band → A
Next band → T

So the sequence becomes:

TGAT...

How the fragments were produced

This slide shows how those fragments in the gel were created.

1. DNA template

The DNA you want to sequence is:

TCAGTAATGCCA

DNA polymerase synthesises the complementary strand.

2. Four sequencing reactions

The reaction mixture is split into four tubes:

Each tube also contains:

• DNA polymerase

• primer

• normal nucleotides (dNTPs)

3. Chain termination

Sometimes a ddNTP is incorporated instead of a normal nucleotide.

When this happens:

❌ DNA synthesis stops

because ddNTP lacks the 3'-OH group.

So fragments of different lengths are produced.

Example in the ddATP tube:

TCAGTAA
TCAGTAAT
TCAGTAATGCCA

All fragments end with A.

4. Running the gel

Fragments from each tube are loaded into the gel lanes:

A   C   G   T

The gel separates fragments by size.

5. Reading the final sequence

Reading the bands from bottom → top gives:

A
C
C
G
T
A
A
T
G
A
C
T

So the sequence is:

ACCGTAATGACT

The key concept of the slides

Sanger sequencing works because:

1. ddNTP randomly stops DNA synthesis

2. This creates DNA fragments of different lengths

3. Electrophoresis separates them

4. The band pattern reveals the DNA sequence

✅ The most important rule to remember

Always read Sanger sequencing gels from bottom → top.

ANSWER:

GAATCGCTATTC

Cyclic Sequencing

This slide shows cycle sequencing, which is a modified Sanger method that works similarly to PCR cycling.

Reaction mixture

The mixture contains:

• Template DNA

• Primer

• DNA polymerase

• Normal nucleotides (dNTPs)

• Fluorescent ddNTPs (ddA, ddC, ddG, ddT)

Each ddNTP has a different fluorescent colour.

Steps of Cyclic Sequencing (in order)

1. Denaturation

• The double-stranded DNA separates into two single strands.

• This happens at high temperature (~95 °C).

• The template strand becomes available for the primer.

2. Primer Hybridisation (Annealing)

• The primer binds to the complementary sequence on the template DNA.

• This occurs at a lower temperature (~50–60 °C).

3. Extension (DNA synthesis + chain termination)

• DNA polymerase extends the primer.

• It adds:

  • normal nucleotides (dNTPs) → continue DNA synthesis

  • fluorescent ddNTPs → occasionally inserted and terminate the chain

A
AC
ACC
ACCG
ACCGT

Each fragment ends with a fluorescent base.

4. Repeat the cycle

The steps repeat 25–35 times:

Denaturation → Annealing → Extension → repeat

Each cycle produces more terminated fragments of different lengths.

5. Fragment separation and detection

After cycling is finished:

1. DNA fragments are separated by capillary electrophoresis

2. A laser detects the fluorescent base at the end of each fragment

3. The computer reconstructs the DNA sequence

Each fragment ends with Radioactive vs Fluorescent Sequencing

This slide compares the old method with the modern method.

Left side: Radioactive sequencing (old)

Features:

• 4 separate reactions

• 4 gel lanes

A | C | G | T

Each lane corresponds to a different ddNTP.

Detection method:

• radioactive labeling

• autoradiography (X-ray film)

The sequence is read manually from the gel.

Right side: Fluorescent sequencing (modern)

Features:

• 1 reaction instead of 4 (i.e., has 1 lane instead of 4).

• All 4 ddNTPs in one tube

• Each base has a different fluorescent colour

Example:

Fragments are separated by capillary electrophoresis, and a laser detects the colour.

The machine automatically converts the colours into the DNA sequence.

REMEMBER: The large weight fragments are on the top while the small weighted ones are located at the bottom

Fluorescent Fragment Detection

This slide shows how the fragments are read automatically.

Step 1: DNA synthesis

DNA polymerase produces fragments of different lengths.

Example fragments:

T
TC
TCA
TCAG
TCAGT
TCAGTA

Each fragment ends with a fluorescent ddNTP.

Step 2: Electrophoresis

Fragments move through capillary electrophoresis.

Important rule:

• Small fragments arrive first

• Large fragments arrive later

Step 3: Laser detection

A laser detects the color of the last base.

Example signal sequence:

green
blue
blue
yellow
red
green
green
red
yellow
green
blue
red

The computer converts colors → bases.

Final sequence produced

Example:

ACCGTAATGACT

An electropherogram is a graph of colored peaks representing the DNA sequence detected during automated Sanger sequencing.

Key idea of Next Generation Sequencing:

Instead of sequencing one DNA fragment at a time (like Sanger sequencing), NGS sequences millions of fragments simultaneously.

What are the characteristics of Next Generation Sequencing:

• Extremely versatile

• Parallel sequencing: simultaneous sequencing of millions of DNA fragments.

• Decrease costs—> increasing clinical applications.

Applications of NGS (from the slide)

Targeted DNA sequencing

Sequencing one specific gene.

Example:

• checking for a mutation in a disease gene

Fast and cheap.

Gene panel sequencing

Sequencing a group of related genes.

Example:

• cancer gene panels

• hereditary disease panels

Used when multiple genes could cause a disease.

Exome sequencing

Sequences all exons in the genome.

Exons = protein-coding parts of genes

Only about 1–2% of the genome, but many disease mutations occur there.

Whole genome sequencing

Sequences the entire genome.

This gives the most complete genetic information.

Steps of Next-Generation Sequencing:

Step 1: Library preparation

The DNA sample is prepared for sequencing.

This involves:

• cutting DNA into small fragments

• attaching adapters (short DNA sequences)

Adapters allow fragments to bind to the sequencing surface.

Step 2: Amplification (cluster generation)

Each DNA fragment is copied many times.

This produces clusters of identical DNA fragments.

Why?

Because many copies make the signal easier to detect during sequencing.

Step 3: Synthesis-based sequencing

DNA polymerase builds a new complementary strand.

Fluorescent nucleotides are added one at a time.

Each nucleotide emits a colour signal when incorporated.

This allows the machine to determine which base was added.

Step 4: Detection

A camera or laser detects the fluorescent signals.

Each colour corresponds to:

The system records the sequence base by base.

Step 5: Data analysis

Computers analyse the sequencing data.

They:

• assemble DNA fragments

• Align them to a reference genome

• Identify mutations or variations.