Foundations of Cell Biology

Unit 1: Foundations of Cell Biology

I. Introduction

This section provides an introduction to the foundational concepts of cell biology, highlighting that understanding cellular structures and functions is essential in the broader field of biology.

II. Cells Have Similar General Biochemistry

All cells, despite their differences, share similar biochemical processes. They utilize vital biomolecules such as proteins, lipids, carbohydrates, and nucleic acids for essential functions.

III. Cells Make Proteins With Similar Mechanisms

Cells utilize a universal mechanism for synthesizing proteins from genetic information, which involves processes such as transcription and translation.

IV. Microscopy

The study of cell biology has progressed significantly due to advancements in microscopy, allowing scientists to visualize and understand cellular structures in detail.

V. Major Cell Classes

There are two major classes of cells based on their structural complexities: prokaryotic and eukaryotic cells.

VI. Prokaryotic Cells

Prokaryotic cells are characterized by their simplicity; they lack membrane-bound organelles and a distinct nucleus. They contain a single, circular chromosome and are primarily unicellular.

Characteristics of Prokaryotic Cells:

  • Small and simple in nature

  • Lack organelles and nucleus

  • Single-celled organisms

  • Have DNA and ribosomes

VII. Eukaryotic Cell Evolution (Endosymbiosis)

Eukaryotic cells evolved from prokaryotic ancestors through a process called endosymbiosis, which explains the origin of complex cells with organelles.

VIII. Cell Groups and Relationships

Cells are organized in various relationships, forming groups such as unicellular and multicellular organisms.

IX. Broad Grouping of Cells

Cells can be broadly categorized into Archaea, Eubacteria, Protists, Fungi, Plants, and Animals, collectively known as life's three domains:

  • Prokaryotes: Archaea and Eubacteria

  • Eukaryotes: All multicellular organisms and some unicellular organisms

X. Eukaryotic Cells

Eukaryotic cells have complex structures with membrane-bound organelles, such as the nucleus and mitochondria.

Characteristics of Eukaryotic Cells:

  • Larger and more complex than prokaryotic cells

  • Contain a nucleus and organelles

  • May be unicellular or multicellular

XI. Eukaryotic Cell Structure Review

Review the structure of eukaryotic cells, focusing on organelles and their specific functions:

A) Cell Nucleus

  • Contains the genetic material and is made up of a double membrane

  • Nuclear pores regulate the passage of molecules

  • The nucleolus is involved in ribosome production

B) Mitochondria

  • Sites of cellular respiration, generating ATP

  • Possess their own DNA and replicate independently

  • Have an inner membrane with folds called cristae

C) Chloroplasts

  • Present only in plants for photosynthesis

  • Contain chlorophyll for light absorption

  • Site of carbohydrate synthesis

D) Endoplasmic Reticulum (ER)

  • Rough ER: Studded with ribosomes for protein synthesis

  • Smooth ER: Involved in lipid synthesis and detoxification processes

E) Golgi Apparatus

  • Modifies, sorts, and packages proteins received from the rough ER

  • Synthesizes polysaccharides

F) Lysosomes and Peroxisomes

  • Lysosomes: Contain enzymes to digest cellular debris and waste

  • Peroxisomes: Break down fatty acids and detoxify harmful byproducts

G) Vacuoles

  • Store water and maintain turgor pressure in plant cells

  • Can store nutrients and waste products

XII. Model Research Organisms

Characteristics of ideal model organisms for cell biology research:

  • Easy to maintain and manipulate in laboratory conditions

  • Short generation times

  • Produce large numbers of offspring

  • Well-studied with extensive documentation

Examples of Model Organisms:

  • Saccharomyces cerevisiae (Yeast)

  • Arabidopsis thaliana (Wall Cress)

  • Drosophila melanogaster (Fruit Fly)

  • Caenorhabditis elegans (Round Worm)

  • Escherichia coli (Bacterium)

XIII. Early Cell Evolution (Biological Timescale of Earth)

The timeline of significant events in Earth's biological history:

  • Formation of Earth: 4.65 billion years ago (BYO)

  • First Cellular Life: Around 4 BYO

  • First Photosynthetic Organisms: Approximately 3.5 BYO

  • Oxygen Accumulation in Atmosphere: About 2 BYO, leading to the evolution of aerobic eukaryotic life

  • First Multicellular Organisms: Around 800 million years ago (MYO)

XIV. DNA Replication, Transcription and Translation

A) DNA Structure

  • DNA (Deoxyribonucleic Acid) encodes genetic information; consists of four nitrogen bases: Adenine (A), Guanine (G), Cytosine (C), and Thymine (T).

  • Base pairing occurs as A pairs with T, and G pairs with C, held together by hydrogen bonds.

  • DNA replication is semiconservative, each strand serves as a template for new strands.

B) Transcription

  • The process of synthesizing messenger RNA (mRNA) from a DNA template using the enzyme RNA polymerase.

  • Example: The DNA sequence ATTGCCGCTGGACCAT is transcribed to the mRNA sequence UAACGGCGACCUGGUA.

C) Translation

  • The process of synthesizing proteins from mRNA.

  • Involves ribosomes, transfer RNA (tRNA), and amino acids which are encoded by the mRNA sequence via codons.

  • Translation begins at the first AUG codon and stops at stop codons (UAA, UAG, UGA).

  • Example: mRNA sequence CUUAGAAUGCCAGCUUAACGGAGG translates to Met-Pro-Ala-STOP (where Met represents Methionine).

D) Cellular Respiration

  • The process of converting energy from organic molecules into usable energy (ATP).

  • Anaerobic respiration: does not require oxygen, less efficient (produces 2 ATP/glucose).

  • Aerobic respiration: requires oxygen, more efficient (produces ~37 ATP/glucose).