Genetics Ch. 14 - RNA Molecules and RNA processing

Chapter 14 RNA Molecules and RNA Processing

Overview of RNA Types

  • Messenger RNA (mRNA): The molecule that conveys genetic information from DNA to the ribosome, where proteins are synthesized. It serves as a template for the sequence of amino acids in a protein, carrying the code from the DNA in the nucleus to the ribosomes in the cytoplasm.

  • Transfer RNA (tRNA): Serves as an adapter that translates the codon sequence of mRNA into the corresponding amino acids during protein synthesis. Each tRNA molecule carries a specific amino acid and has a specific anticodon that pairs with a complementary codon in the mRNA.

  • Ribosomal RNA (rRNA): A key structural and functional component of ribosomes, which are the sites of protein synthesis in cells. rRNA molecules help to form the ribosome’s structure and catalyze the formation of peptide bonds between amino acids.

Transcription and Translation

  • Transcription Directionality: RNA is synthesized from the 5' to 3' direction. In contrast, the DNA template is typically depicted as going from 5' to 3', allowing RNA polymerase to add RNA nucleotides complementary to the template DNA strand.

  • Example Sequence:

    • DNA: CGTGGATACACTTTTGCCGTTTCT

    • mRNA: CGUGGAUACACUUUUGCCGUUUCU

  • Codons: Sequences of three nucleotides in mRNA that specify particular amino acids. Each codon corresponds to a specific amino acid or stop signal during protein synthesis.

  • Amino Acids Examples:

    • Arg (Arginine)

    • Gly (Glycine)

    • Tyr (Tyrosine)

    • Thr (Threonine)

    • Phe (Phenylalanine)

    • Ala (Alanine)

    • Val (Valine)

    • Ser (Serine)

  • Colinearity: The linear order of nucleotides in a gene directly correlates with the linear order of amino acids in the resulting protein, demonstrating the direct relationship between DNA sequence and protein structure.

Eukaryotic vs. Prokaryotic mRNA

  • General Processing Differences:

    • Bacteria: mRNA is synthesized and translated simultaneously in the cytoplasm. Since bacteria lack a nucleus, the processes happen concurrently without the need for modifications.

    • Eukaryotes: Primary RNA transcripts (pre-mRNAs) undergo several processing steps before translation, including capping, polyadenylation, and splicing. Synthesis occurs in the nucleus, and mRNA must be modified and exported to the cytoplasm before translation can occur.

mRNA Structure

  • 5' Untranslated Region (5' UTR): Contains sequences (e.g., Shine-Dalgarno sequence in bacteria) that facilitate ribosome binding and regulate translation efficiency.

  • Protein Coding Region: Contains codons that specify the amino acid sequence of proteins, determining the protein's function.

  • 3' Untranslated Region (3' UTR): Plays a role in stabilizing mRNA and facilitating ribosome binding and export. It also contains regulatory regions that influence gene expression.

Eukaryotic mRNA Processing Steps in mRNA Processing

  • 5' Cap Addition: A modified Guanine nucleotide is added to the 5' end via a 5'-5' triphosphate bridge, enhancing mRNA stability and ribosome recognition. It protects mRNA from degradation and is recognized by the ribosome during initiation of translation.

  • Poly(A) Tail Addition: A series of 50-250 adenine nucleotides are added to the 3' end of the mRNA, further stabilizing the mRNA and aiding in its transport out of the nucleus, preventing degradation.

  • Splicing: Involves the removal of non-coding introns and the joining of exons to create a mature mRNA that can be translated into a protein.

Splicing Mechanism

  • Key Sites:

    • 5' splice site: The beginning of the intron; cleaved and forms a lariat structure with the branch point.

    • 3' splice site: The end of the intron, which links exons together to form a continuous coding sequence after splicing.

  • Spliceosome: A complex made of small nuclear ribonucleoproteins (snRNPs) and additional proteins that are responsible for recognizing splice sites and catalyzing splicing events.

rRNA and Ribosomes

  • Structure of Ribosomes: Composed of large and small subunits, which integrate rRNA and proteins. The large subunit is responsible for catalyzing peptide bond formation, while the small subunit binds to mRNA.

  • Ribosomal RNA (rRNA): The most abundant RNA type, critical for ribosome function and protein synthesis. It forms the core of ribosome structure and its catalytic sites.

Eukaryotic rRNA Processing

  • Precursor rRNA: Undergoes post-transcriptional modifications, including methylation and cleavage, yielding functional rRNAs: 18S, 5.8S, 28S. These modifications are essential for the proper assembly and function of rRNA in ribosomes.

  • Key Processes:

    • Modification by small nucleolar RNAs (snoRNAs): These guide the chemical modifications of rRNA, ensuring the correct structure for ribosome assembly.

    • Assembly: Involves combining modified rRNA with ribosomal proteins to form complete ribosomal subunits, eventually culminating in functional ribosomes.

Transfer RNA (tRNA)

  • Function of tRNA: Acts as an adapter molecule that connects mRNA codons to their corresponding amino acids during protein synthesis. This ensures that the genetic instructions in mRNA are accurately translated into the language of proteins.

  • Structure of tRNA: Typically adopts a 3D L-shape due to the formation of cloverleaf structures arising from base-pairing interactions. Each tRNA molecule has a unique structure that enables it to fulfill its role in translation.

  • Unique Nucleotide Bases: Generated through post-transcriptional modifications, which can include methylation and conversion of standard bases to modified versions, increasing the stability and functionality of tRNA.

  • 3' End: Always concludes with a CCA sequence where the corresponding amino acid attaches, ensuring the proper amino acid is delivered to the growing polypeptide chain.

Alternative mRNA Processing

  • Importance of Alternative Splicing: Approximately 70% of human genes undergo alternative splicing, allowing a single gene to encode multiple protein products. This increases the diversity of proteins and functions within a cell.

  • Tissue-Specific Splicing: Different splicing mechanisms can occur based on specific tissue types or prevailing cellular conditions, contributing to cellular diversity and functionality. This process can be regulated by splicing factors and the cellular environment.

Homework Problems

1, 2, 5, 6, 7, 8, 10, 13, 15, 22*, 24, 25, 28*, 33*, 36.