Genetic Markers in Wildlife Conservation

Introduction to Genetic Markers

  • In wildlife conservation research, it is crucial to identify the appropriate genetic markers suitable for specific scientific questions.

Learning Outcomes

  • At the end of the session, students should be able to:
    • Identify genetic markers to use based on scientific questions in wildlife conservation.

Genetic Polymorphism

  • Definition: The presence of multiple variant forms of a specific DNA sequence or gene within a genome.
  • Occurrence:
    • Among different individuals
    • Within a population
    • Among different populations
  • Causes:
    • Changes in DNA content (point mutations)
    • Variations in the size/length of DNA fragments
    • Variations in the number of gene copies (loci)
Types of Genetic Polymorphism
  1. Single-Nucleotide Polymorphisms (SNPs)
    • Variability at a single nucleotide position in the nuclear genome.
    • Caused by DNA substitutions or mutations.
  2. Insertion/Deletion (Indel)
    • Specific nucleotide sequences that can either be inserted or deleted from an individual's genome.
  3. Variable Number of Tandem Repeats (VNTRs)
    • Repeats of DNA sequences (≥2 bp) that can range from a few to thousands of copies, organized in a head-to-tail orientation.
    • Includes microsatellites (1-6 bases) and minisatellites (8-100 bases).
  4. Variability in Gene/Loci Copies
    • Presence of more than one copy of genes or loci, e.g., immune system genes like those from the major histocompatibility complex (MHC).

Importance of Genetic Markers

  • Applications:
    • Identification of individuals/species.
    • Resolution of taxonomic uncertainties.
    • Assessment of genetic diversity within populations.
  • Informing Conservation:
    • Identification of conservation units (ESUs, MUs).
    • Understanding effects of genetic diversity loss and inbreeding.
    • Guiding breeding and reintroduction programs.

Classifications of Genetic Markers

  1. Based on Parental Source:

    • Uniparental:
      • Mitochondrial DNA (mtDNA) - maternally inherited.
      • Chloroplast DNA (cpDNA) - maternally inherited (not in all plants).
      • Y-chromosome (partially paternal, nuclear).
    • Biparental:
      • Nuclear DNA, inherited from both parents.

  2. According to Evolutionary Constraints:

    • Neutral Genetic Markers:
      • Provide insights into population demographics (e.g., gene flow).
      • Not influenced by selection.
    • Adaptive Genetic Markers:
      • Reveal adaptive evolutionary history and potential.
      • Influenced by environmental pressures and selection.

Nuclear DNA Markers (Biparental)

  • **Variable Number of Tandem Repeats (VNTR):
    • High degree of length polymorphism.
    • Helps understand genetic diversity, population dynamics, and inbreeding.
  • **Microsatellites:
    • Motifs of 1–6 bases that repeat 5-100 times.
    • Help assess genetic diversity.
    • Co-dominant markers, specific to species with positions in genomes.
Usage of Microsatellite Markers
  • Highly polymorphic and easily amplified via PCR.
  • Unique identification of species and loci based on allele length.
  • Example: TGAACGAACACACACACACACACACACACACACGCCGT (specific allele length and repeats).
Genotype Frequencies in Populations
  • Example Calculation:
    • N = 103 (total individuals)
    • Genotype Frequencies:
    • 38/28 = 68/103 = 0.66
    • 28/28 = 31/103 = 0.30
    • 38/38 = 4/103 = 0.04
    • Total Allele Calculation:
    • Total copies of 28 = 167
    • Total copies of 38 = 39

Single Nucleotide Polymorphisms (SNPs)

  • Characterized by single substitutions at specific sites.
  • Frequencies of SNPs occur every 300-1000 bp.
  • Identification through genome sequencing.
Genotyping SNPs
  • Approaches include:
    • Whole genome sequencing.
    • Targeted methods (PCR, SNP chips).
  • Reduced-Representation Sequencing (RRS):
    • Involves restriction digestion, size selection, and sequencing of fragments.