AW

Chapter 7: Transcription

Chapter 7 (Part 1): Transcription

DNA vs. RNA

  • Key differences between DNA and RNA:

    • Structure:

    • DNA: Double helix structure

    • RNA: Single-stranded structure that can fold into complex shapes

    • Sugar:

    • RNA contains ribose

    • DNA contains deoxyribose

    • Base Differences:

    • RNA uses uracil (U) while DNA uses thymine (T)

Transcription in Prokaryotes and Eukaryotes

The Central Dogma

  • Describes the flow of genetic information:

    • DNA → transcription → RNA → translation → Protein

Definition of Transcription

  • Transcription: The first step in gene expression, which is the process by which a gene makes a product useful to the cell or organism by directing the synthesis of a protein or an RNA molecule with specific activity.

    • Note: Gene expression can occur at different rates.

    • Transcription 'machinery' recognizes genes and copies the instructions into RNA.

Structure of RNA and DNA

  • 5' end and 3' end: indicate the orientation of the nucleic acids and how nucleotides are added during transcription

  • Nucleotide Composition:

    • RNA comprises ribonucleotides which are linked by phosphodiester bonds.

    • Differences in sugar:

    • Ribose in RNA

    • Deoxyribose in DNA

    • Base differences:

    • Uracil (U) in RNA

    • Thymine (T) in DNA

RNA Structure

  • RNA can fold into complex structures due to its single-stranded nature allowing it to form various configurations similar to proteins.

RNA Transcription Process

  • DNA as a Template for RNA Synthesis:

    • Transcription produces an RNA transcript complementary to one strand of DNA:

    • Coding strand (non-template strand): This strand has the same sequence as the RNA transcript (except T is replaced with U).

    • Template strand: The strand that is actually read and transcribed.

  • RNA Polymerase Mechanism:

    • RNA polymerase synthesizes RNA in the 5’ to 3’ direction, where nucleotides are added to the 3’ end of the growing RNA strand.

Types of RNA

  • Multiple types of RNA exist, each with distinct functions:

    • Messenger RNA (mRNA): Codes for proteins; Transcribes information directly from DNA.

    • Ribosomal RNA (rRNA): Forms the core of ribonucleoprotein complexes and catalyzes protein synthesis.

    • MicroRNA (miRNA): Regulates gene expression.

    • Transfer RNA (tRNA): Functions to bring amino acids to the ribosome during protein synthesis.

    • Noncoding RNAs: Final products of gene expression and fulfill various roles including regulation and structural components.

Transcription in Prokaryotes

  • Promoter Site: Located upstream from the gene, attracts RNA polymerase for initiating transcription. The Sigma Factor recognizes the promoter site and facilitates transcription.

  • Terminator Site: This sequence signals the end of transcription, causing RNA polymerase and the RNA transcript to be released.

DNA Sequence in Prokaryotic Transcription

  • Promoter and Terminator Coding:

    • Example of Promoter:

      • 5' TAGTGTATTGACATGATAGAAGCACTCTACTATATTCTCAATAGGTCCACG 3'

    • Example of Terminator:

      • 5' CCCACAGCCGCCAGTTCCGCTGGCGGCATTTTAACTTTCTTTAATGA 3'

Transcription in Eukaryotes

Eukaryotic Promoter Structure

  • Eukaryotic promoters consist of a TATA box and other sequence elements that are crucial for the binding of transcription factors necessary for RNA polymerase positioning.

General Transcription Factors (GTFs)

  • GTFs, which include TFIIB and TBP (TATA-binding protein), gather at the promoter site to initiate transcription. They are essential for RNA polymerase activation.

RNA Processing

  • Enzymes involved in processing transcribed RNA include modifications such as:

    • RNA Capping: Methylated Guanine is added to the 5’ end to protect the RNA from degradation and assist in ribosomal binding during translation.

    • Polyadenylation: Addition of a poly-A tail to the 3' end, enhancing RNA stability and export.

Splicing in Eukaryotic Transcription

  • Eukaryotic genes often contain noncoding segments called introns, which must be cut out, leaving exons that coded for proteins. This process is carried out by a complex called the spliceosome.

    • Spliceosome: A large assembly of RNA molecules and proteins that perform splicing in the nucleus during RNA synthesis. Introns are excised forming lariat structures.

Export of Mature mRNA

  • After splicing and processing, mature mRNA is exported from the nucleus through nuclear pores, assisted by factors like cap-binding proteins and poly-A-binding proteins before it enters the cytosol for translation.

Comparative Overview of Transcription in Eukaryotes and Prokaryotes

Eukaryotic Process:

  • Involves the following steps:

    • Transcription in the nucleus

    • Formation of a pre-mRNA transcript

    • RNA capping and polyadenylation

    • Splicing to form mature mRNA

    • Export from nucleus to cytoplasm for translation.

Prokaryotic Process:

  • Simpler process:

    • Transcription occurs in the cytoplasm

    • Directly involves mRNA without the need for splicing and processing before translation.

Overall Summary

  • The key difference between prokaryotic and eukaryotic transcription lies in the complexity and additional processing steps required in eukaryotes. Prokaryotes utilize simpler mechanisms with no intron processing.