9-4 Introduction to RNA - Tagged

Introduction to RNA

RNA (Ribonucleic Acid)RNA is essential for various biological functions and plays a key role in the synthesis of proteins. It is a crucial molecule in the process of gene expression that involves the creation of proteins based on the instructions encoded in DNA.

Central Dogma of Molecular Biology

Central DogmaThe framework for understanding the flow of genetic information can be summarized in the central dogma of molecular biology:DNA undergoes replication to create copies of itself, which can then be transcribed into RNA. This RNA goes through translation to form proteins, the workhorses of the cell that perform various functions crucial for life.

DNA vs RNA

Comparison

• DNA:

  • Structure: Double-stranded helix for stability

  • Base: Thymine (T), which complements adenine (A)

  • Sugar: Deoxyribose, lacking a hydroxyl group at the 2'-carbon

  • Role: Stores and transmits genetic information.

• RNA:

  • Structure: Single-stranded, allowing it to fold into complex shapes useful for its functions

  • Base: Uracil (U) replaces thymine, pairing with adenine

  • Sugar: Ribose, includes a hydroxyl group on the 2'-carbon, making it more reactive and versatile than DNA

  • Role: Involved in translating the genetic code into proteins and various cellular functions.

Structure of RNA

5' and 3' EndsRNA strands are directional and have distinct 5' and 3' ends, which determine the directionality of synthesis and function.

Components:

• Ribose sugar

• Phosphate groups

• Nitrogenous bases

• The presence of a hydroxyl group at the 2'-carbon of ribose distinguishes RNA from DNA, impacting its stability and function.

Complementary Regions

Formation of Secondary StructuresRNA can fold into secondary structures due to hydrogen bonding between complementary bases on the same strand, which is vital for its biological activity.

Example sequence:

5' AUGCGGCUACGUAACGAGCUUAGCGCGUAUACCGAAAGGGUAGAAC 3'Folding leads to formations such as hairpins or stem-loops, which can play roles in regulation and function within the cell.

Functions of RNA Secondary Structure

RNA Secondary StructuresVarious types of secondary structures evolve from the ability of RNA to base-pair with itself:

• Loop: Single-stranded regions often involved in recognition and binding

• Stem: Double-stranded regions that provide stability

Functions derived from structure:

• Act as acceptor arms and anticodon arms crucial in tRNA for amino acid incorporation during protein synthesis.

Classes of RNA Molecules