Notes on Single Nucleotide Polymorphism and Bitter-Tasting Ability

Scientific Discoveries and Modern Biological Research

• Scientific discoveries are often accidental and provide the basis for evolving theories.
• Modern biological research merges genetics, biochemistry, comparative studies, and bioinformatics.

Receptors and Genetic Differences

• Genetic differences influence taste, smell, and drug efficacy via receptors.

Genotype and Phenotype

• Can genotype accurately predict phenotype?
• Genetic engineering can create restriction enzyme sites.
• Restriction Fragment Length Polymorphism (RFLP) generation and its uses in biotechnology and medicine.

Taste in Mammals

• Mammals distinguish five basic tastes: sweet, sour, bitter, salty, and umami.

Taste Perception Process

• Taste perception is a two-step process:
  1. A taste molecule binds to a specific receptor on the surface of a taste cell.
  2. The taste cell generates a nervous impulse, which is interpreted by the brain.
  • Cellular receptors are proteins either inside a cell or on its surface.
  • Chemical signal: A signaling molecule (ligand) binds a protein receptor.

Ligand-Receptor Interactions

• Biological receptors generally bind tightly to a single natural ligand.
• Receptors are proteins made of amino acids that fold into a 3-dimensional shape.
• Changes in amino acids (due to differences in DNA) can alter the ability to bind a ligand.

Taste Sensation

• Stimulation of “sweet cells” generates a perception of sweetness in the brain.
• Taste sensation is determined by how a taste cell is wired to the cortex in the brain.
• A bitter molecule can be perceived as sweet if a sweet cell expresses a bitter taste receptor.

Taste Recognition

• Taste recognition is mediated by specialized taste cells communicating with several brain regions through direct connections to sensory neurons.

Taste Cells and Receptors

• Taste cells have taste receptors, which are transmembrane proteins.
• Taste receptors recognize food molecules and activate taste cells.
• Taste cells are assembled into three different types of papillae in the tongue epithelium: circumvallate, foliate, and fungiform.
• Different papillae display bias in their sensitivity to different taste qualities.
  • Circumvallate papillae: sensitive to bitter compounds.
  • Fungiform papillae: show strong salty and sweet responses.

Taste Receptor Types

• Transmembrane protein receptors include:
  • Taste GPCRs (T1Rs, T2Rs)
  • Ion channels (ENaC)
  • Transporters (GLUT4 and SGLT1)

Taste as an Inherited Trait

• Genetic variants influence food preferences.

Serendipitous Observation of PTC Tasting

• The genetic basis of taste was first observed by accident in the 1930s with phenylthiocarbamide (PTC).
• Arthur Fox at DuPont Company in the late 1920s. His lab partner C.R. Noller complained of a bitter taste, but Fox had no taste.
• Albert Blakeslee at Carnegie Department of Genetics showed that the inability to taste is recessive (published in 1932).

Punnett Square and PTC Tasting

• Punnett Square example:
  • TT = Taster
  • tt = Nontaster
  • Dad (TT) has all “tasting” receptors; Mom (tt) has all “non-tasting” receptors.
  • Kids (Tt) have both and can taste PTC.

Molecular Genetics of PTC Tasting

• Gene identified in 2003 by Dennis Drayna is the TAS2R38 gene.
• Polymorphism associated with PTC tasting is a SNP (Single Nucleotide Polymorphism) at nucleotide position 145.
  • Taster = C
  • Nontaster = G
  • Change in Amino acid 49: Proline to Alanine

Analysis of the Trait - CAPS

• CAPS: Cleavage amplified polymorphisms.
• Amplify a region of TAS2R38 gene by PCR.
• Primers used in the experiment:
  • CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG
  • AGGTTGGCTTGGTTTGCAATCATC
• Cut with restriction enzyme (HaeIII).
• RFLP: Restriction Fragment Length Polymorphism

TAS2R Bitter Taste Receptor and HaeIII

• PCR product (221 bp).
• Digest with HaeIII restriction enzyme (recognition sequence GGCC).
• Taster: GGCGGCCACT (cut into 45 bp and 176 bp fragments).
• Nontaster: GGCGGGCACT (remains uncut at 221 bp).

Analysis by Electrophoresis

• Gel electrophoresis separates DNA fragments by size.
• Taster allele shows two bands (45 bp and 176 bp).
• Nontaster allele shows one band (221 bp).

Evolutionary Relationships

• What is the relationship between this trait and our ancestors?
• What is the normal state: to taste or not to taste?

Multiple Sequence Alignment

• Comparison of sequences from different species including Chimp, Gorilla, Human (taster and non-taster), and Pan paniscus.
• Shows conserved regions and variations in the TAS2R38 gene.

Advantage: Taste or Not to Taste?

• What are the evolutionary advantages of tasting or not tasting PTC?

More Complication: Multiple PTC Haplotypes

• Polymorphisms at different positions:
  • 145: C (proline) / G (alanine)
  • 785: C (alanine) / T (valine)
  • 886: G (valine) / A (isoleucine)

HaeIII and the Taster Allele

• HaeIII restriction site = GGCC
• Neither taster (GCAGGCAGCCACT) nor nontaster (GCAGGCAGGCACT) alleles have the GGCC restriction site in the region around SNP 145.

Primer and Sequence Comparison

• Primer: CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG
• Mismatch when the primer binds to the DNA sequence.
• Taster: TAGTGAAGAGGCAGCCACTG
• Nontaster: TAGTGAAGAGGCAGGCACTG

PCR and HaeIII Site Creation

• New DNA sequence made by PCR:
  • TTTTTGGGATGTAGTGAAGAGGCGGCCACTG
• Next round of PCR copies the new sequence, changing it to DNA with the RE site.

After PCR

• HaeIII cut site:
  • Taster: TAGTGAAGAGGCGGCCACTG
  • Nontaster: TAGTGAAGAGGCGGGCACTG

Results of PCR

• Gel electrophoresis results showing different banding patterns for TT, TN, and NN genotypes.

PTC Taste Receptor – Genotype à Phenotype

• Classical dominant/recessive inheritance.
• Dominant: one copy of a gene expresses the trait.
• Recessive: two copies are needed for expression.

Creating a RFLP

• HaeIII enzyme discriminates between the C-G polymorphism.
• HaeIII cuts at the sequence GGCC (143-145 position of the PCR product).
• Nontaster has GGGC and won’t cut.

Bioengineering

• The forward primer has the HaeIII recognition site GGCC.
• Gene sequence has an A, but the primer has a G.

PCR and Primer Sequence Override

• PCR product always has the same sequence as the primer.
• This creates a HaeIII restriction site in the taster allele but not the non-taster.

Mutations

• Synonymous: No change in amino acid sequence.
• Nonsynonymous: Results in amino acid replacements.
• The G-C polymorphism in TAS2R38 is a nonsynonymous mutation.
  • Taster: CCA = proline
  • Nontaster: GCA = alanine

Other Mutations in TAS2R38

• Different positions and amino acid changes:
  • 145: C (proline) / G (alanine)
  • 785: C (alanine) / T (valine)
  • 886: G (valine) / A (isoleucine)
• These mutations influence bitter taste perception and are inherited together.

Nontasters and Natural Selection

• Many people are nontasters. More than expected.
• Advantage to being a heterozygote.
• Nontasting form allow for individuals to taste another type of bitter molecule and so these people may know to avoid potentially toxic compounds. Also the heterozygote may have an advantage to avoid poisonous, yet still enjoy nutritious.

Ethical Issues

• Consent
• Knowledge of use
• Storage or destruction of samples after use

Olfactory Receptors (ORs)

• Largest mammalian gene family (~1,000 genes or 4% of total genes).
• Can detect ~10,000 different odors.
• Each OR gene expressed in 1 in 1,000 epithelial cells.
• Multiple receptors bind different parts of an odorant molecule.
• Odor code: different odorant molecules are detected by different combinations of receptors.

Flavors - Combo of Taste and Smell

• Taste cells (Gustatoreceptors):
  • Occur in taste buds on tongue, palate, epiglottis, and pharyngeal wall.
  • Only taste the food.
  • Specialized epithelial cells (Secondary sense cells).
  • Crescentic in form.
  • Free ends taper and bear microvilli.
  • Sensory nerve fibers form synapses.
  • Function only as sensory receptors.
  • Stimulated by chemicals in high concentrations.
• Olfactory cells or Smell receptors (Olfactoreceptors):
  • Occur in a small patch of olfactory epithelium lining the roof of the nasal cavity.
  • Smell as well as taste the food.
  • Bipolar neurons (primary sense cells).
  • Spindle shaped in form.
  • Free ends of dendrites enlarge into vesicles.
  • Axons of olfactory cells act as sensory fibers.
  • Function as sensory receptors as well as conducting neurons.
  • Stimulated by chemicals from a distance and in much lower concentrations.

Olfactory Receptor Evolution

• Mice: 20% of ORs are inactive.
• Primates: 30-40% of ORs are inactive.
• Humans: 60% of ORs are inactive.
• OR genes are diverging quickly and under natural selection.

Pharmacogenetics

• Examines the impact of genetic variation on response to medications.
• Examples:
  • Herceptin for breast cancer with HER2 overexpression.
  • New Lupus drugs, Asthma drugs.
  • SNPs predict adverse responses to anti-depression drugs.
  • Warfarin (Coumadin) action and metabolism.

Results of the PTC Taste Receptor - 2012

• How well does TAS2R38 genotype predict PTC-tasting phenotype?
• Phenotype vs. Genotype data.

Results of the PTC Taste Receptor - 2022

• Positive PCR = 32.
• Nontaster (-/-) = 13.
• Weak Taster (+/-) = 10.
• Strong Taste (+/+) = 9.
• Phenotype vs. Genotype data.

Results of the Amplification and Restriction Digest of PTC receptor

• PCR results = 23
• Phenotype vs. Genotype data for Strong Taster, Weak Taster, and Nontaster.

Gel Electrophoresis of PCR Amplified DNA for TAS2R38

• Gel electrophoresis results.
• Gel electrophoresis results.
• Gel electrophoresis results.

Results of PTC Receptor PCR

• Results of the electrophoresis.
• Results of the electrophoresis.
• Results of the electrophoresis.

2012 Phenotype vs Genotype Data

• TT 8/40 or 20%
  *TN = 19/40 or 48%
  *NN = 13/40 or 32%

2015 Results of thePTC Taste Receptor according to class data.

2017 PTC Taste Receptor Data with Positive PCR=37

2021 Results of thePTC Taste Receptor with Positive PCR=18