Evolutionary processes_spring2025_part1

Heritable Variation

  • Individuals within a population exhibit variation.

  • Populations tend to grow exponentially; however, they are limited by resources, leading to a struggle for existence.

  • Variation plays a critical role in this struggle.

Darwin’s Theory of Evolution by Natural Selection

  • Natural selection acts on variation present in populations.

  • The outcome of natural selection is adaptation, which refers to the development of adaptive features that enhance survival and reproduction.

Evolutionary Processes

  • Natural selection is one of several processes responsible for evolution, defined as changes in allele frequencies within a population.

Other Evolutionary Processes

  1. Mutation: Random changes in DNA sequences that can introduce new genetic variations.

  2. Genetic Drift: Random fluctuations in allele frequencies due to sampling errors, predominantly affecting small populations.

  3. Gene Flow: Movement of alleles between populations through migration of individuals or gametes, which can introduce new genetic material into a population.

  4. Non-random Mating: Certain patterns of mating can influence allele frequencies within a population.

Mutation: Random Changes in DNA

  • Primarily caused by changes in the base sequence of DNA.

  • The most common type of mutation is a Point Mutation, where a single nucleotide is replaced, leading to a different sequence.

  • DNA consists of nucleotides, which are made up of phosphate, sugar, and four bases: A (adenine), T (thymine), G (guanine), and C (cytosine).

Examples of Point Mutation

  • Original Sequence: ACTGATTGGGCAACCTATTGC

  • Mutated Sequence: ACTGATTGGGTAACCTATTGC

  • Point mutation can result in a different amino acid sequence, affecting phenotype.

  • Example: Sickle cell anemia demonstrates how a mutation can lead to significant changes in red blood cell structure, from normal to sickle-shaped cells.

Types of Mutations

  • Variations include point mutations, insertions, and deletions of parts of chromosomes.

  • Most mutations are neutral or deleterious, but some can be advantageous in specific environments (e.g., sickle cell allele providing malaria resistance).

Genetic Drift

  • Defined as random changes in allele frequencies due to sampling error.

  • Effects are larger in small populations; the impact of genetic drift is inversely related to population size:

    • Large populations = small effects.

    • Small populations = large effects.

Genetic Bottleneck

  • A specific type of genetic drift that occurs when a population undergoes a dramatic reduction in size, resulting in random genetic changes.

  • Example: The elephant seal population was drastically reduced, leading to the loss of genetic diversity.

Endangered Species and Genetic Bottleneck

  • Many endangered species have experienced a genetic bottleneck, leading to decreased genetic variability, as seen in cheetahs with significantly high percentages of abnormal sperm compared to house cats.

Founder Effect

  • Occurs when a small number of individuals create a new population, leading to a genetic makeup that differs from the parent population.

  • Example: The Amish population in Pennsylvania exhibits higher genetic disorders, like dwarfism, due to the limited genetic diversity of its founders.

Case Study: Tristan da Cunha

  • The island was founded by 15 British settlers in 1814.

  • One individual carried a recessive allele for blindness, resulting in 4 blind descendants and 9 carriers among 264 individuals in 2010.

Gene Flow

  • Refers to the movement of alleles between populations.

  • Involves the migration of gametes/seeds or breeding individuals, resulting in gene flow that can reduce genetic differences.

  • Continued gene flow among populations can lead to greater similarity in allele frequencies, as observed in human populations in the U.S.