Evolutionary processes_spring2025_part1
Heritable Variation
Individuals within a population exhibit variation.
Populations tend to grow exponentially; however, they are limited by resources, leading to a struggle for existence.
Variation plays a critical role in this struggle.
Darwin’s Theory of Evolution by Natural Selection
Natural selection acts on variation present in populations.
The outcome of natural selection is adaptation, which refers to the development of adaptive features that enhance survival and reproduction.
Evolutionary Processes
Natural selection is one of several processes responsible for evolution, defined as changes in allele frequencies within a population.
Other Evolutionary Processes
Mutation: Random changes in DNA sequences that can introduce new genetic variations.
Genetic Drift: Random fluctuations in allele frequencies due to sampling errors, predominantly affecting small populations.
Gene Flow: Movement of alleles between populations through migration of individuals or gametes, which can introduce new genetic material into a population.
Non-random Mating: Certain patterns of mating can influence allele frequencies within a population.
Mutation: Random Changes in DNA
Primarily caused by changes in the base sequence of DNA.
The most common type of mutation is a Point Mutation, where a single nucleotide is replaced, leading to a different sequence.
DNA consists of nucleotides, which are made up of phosphate, sugar, and four bases: A (adenine), T (thymine), G (guanine), and C (cytosine).
Examples of Point Mutation
Original Sequence: ACTGATTGGGCAACCTATTGC
Mutated Sequence: ACTGATTGGGTAACCTATTGC
Point mutation can result in a different amino acid sequence, affecting phenotype.
Example: Sickle cell anemia demonstrates how a mutation can lead to significant changes in red blood cell structure, from normal to sickle-shaped cells.
Types of Mutations
Variations include point mutations, insertions, and deletions of parts of chromosomes.
Most mutations are neutral or deleterious, but some can be advantageous in specific environments (e.g., sickle cell allele providing malaria resistance).
Genetic Drift
Defined as random changes in allele frequencies due to sampling error.
Effects are larger in small populations; the impact of genetic drift is inversely related to population size:
Large populations = small effects.
Small populations = large effects.
Genetic Bottleneck
A specific type of genetic drift that occurs when a population undergoes a dramatic reduction in size, resulting in random genetic changes.
Example: The elephant seal population was drastically reduced, leading to the loss of genetic diversity.
Endangered Species and Genetic Bottleneck
Many endangered species have experienced a genetic bottleneck, leading to decreased genetic variability, as seen in cheetahs with significantly high percentages of abnormal sperm compared to house cats.
Founder Effect
Occurs when a small number of individuals create a new population, leading to a genetic makeup that differs from the parent population.
Example: The Amish population in Pennsylvania exhibits higher genetic disorders, like dwarfism, due to the limited genetic diversity of its founders.
Case Study: Tristan da Cunha
The island was founded by 15 British settlers in 1814.
One individual carried a recessive allele for blindness, resulting in 4 blind descendants and 9 carriers among 264 individuals in 2010.
Gene Flow
Refers to the movement of alleles between populations.
Involves the migration of gametes/seeds or breeding individuals, resulting in gene flow that can reduce genetic differences.
Continued gene flow among populations can lead to greater similarity in allele frequencies, as observed in human populations in the U.S.